Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:474

Tbr1 T-box brain gene 1 ( MGI:107404)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:474
Figure 5J of Acampora et al., 2001 [PMID:11731460] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Image annotation: Arrow points to Tbr1 expression
Expression Pattern Description
Spatial Annotation:
EMAGE:474EMAGE:474Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
474_voxel_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:474_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
Expression was detected in the head region
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1098119
Entity Detected:Tbr1, T-box brain gene 1 ( MGI:107404)
Sequence:sense strand is shown

>MGI:1098119
CCGCCGCGCGCATGGCCGGCGCCAACCCCTATCTGGGCGAGGAGGCCGAGGGCCTGGCGGCCGAGCGCTC
GCCGCTGGCGCCCGCCGCCGAGGACGCCAAGCCCAAGGACCTGTCCGACTCCAGCTGGATCGAGACGCCC
TCCTCCATCAAATCCATCGACTCCAGCGACTCGGGGATTTACGAGCAGGCCAAGCGGAGGCGGATCTCGC
CGGCTGACACGCCGGTGTCTGAGA
nt 1807 - nt 2040 of U49251.1
Notes:The Tbr1 probe used in this study by Acampora et al., 2001 [PMID:11731460] was previously described by Acampora et al., 1997 [PMID:9342056] as a "PCR product spanning the region between amino acid 599 and 680 (Bulfone et al., 1995 [PMID:7619531] )."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:B6D2 F1
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
General Information
Authors:Acampora et al., 2001 [PMID:11731460] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11731460] Acampora D, Boyl PP, Signore M, Martinez-Barbera JP, Ilengo C, Puelles E, Annino A, Reichert H, Corte G, Simeone A 2001 OTD/OTX2 functional equivalence depends on 5' and 3' UTR-mediated control of Otx2 mRNA for nucleo-cytoplasmic export and epiblast-restricted translation. Development (128):4801-13
 [ PMID:9342056] Acampora D, Avantaggiato V, Tuorto F, Simeone A 1997 Genetic control of brain morphogenesis through Otx gene dosage requirement. Development (124):3639-50
 [ doi:10.1016/0896-6273(95)90065-9] [ PMID:7619531] Bulfone A, Smiga SM, Shimamura K, Peterson A, Puelles L, Rubenstein JL 1995 T-brain-1: a homolog of Brachyury whose expression defines molecularly distinct domains within the cerebral cortex. Neuron (15):63-78
Links:MGI:2155386 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI