Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4785

Ppap2c phosphatidic acid phosphatase type 2C ( MGI:1354945)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4785 EMAGE:4785
Figure 1B - antisense. Copyright: This image is from Escalante-Alcalde D; Hernandez L; Le Stunff H; Maeda R; Lee HS; Jr-Gang-Cheng; Sciorra VA; Daar I; Spiegel S; Morris AJ; Stewart CL, Development 2003, 130: 4623-37 [doi:10.1242/dev.00635] and is displayed with the permission of The Company of Biologists who owns the copyright. [PMID:12925589] Figure 1B - sense. Copyright: This image is from Escalante-Alcalde D; Hernandez L; Le Stunff H; Maeda R; Lee HS; Jr-Gang-Cheng; Sciorra VA; Daar I; Spiegel S; Morris AJ; Stewart CL, Development 2003, 130: 4623-37 [doi:10.1242/dev.00635] and is displayed with the permission of The Company of Biologists who owns the copyright. [PMID:12925589]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:4785Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4785_wholemount_moderate_3D_1.wlz
4785_wholemount_possible_3D_1.wlz
4785_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4785_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
embryo
weak weak
Weakly but still widely expressed.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Ppap2c probeA
Entity Detected:Ppap2c, phosphatidic acid phosphatase type 2C ( MGI:1354945)
Sequence:sense strand is shown

>Ppap2c probeA
ATTCGGATCCATGCCTGCTAATGTCACGGAGGCCAGGCTGTCCTTCTACTCTGGCCACTCCTCCTTTGGC
ATGTATTGCATGTTGTTCCTGGCGCTATATGTGCAGGCCCGGCTCTGCTGGAAGTGGGCACGGCTGCTGA
GGCCCACTGTTCAGTTCTTCTTGGTGGCCTTTGCAATCTATGTGGGCTATACCCGAGTGTCTGACCACAA
GCACCACTGGAGTGATGTCCTTGTCGGCCTCCTGCAGGGAGCCCTGGTGGCCTGCCTCACGGTCCGCTAT
GTTTCAGATTTCTTCAAATCCCGGC
Notes:The Ppap2c (LPP2) probe used in this study by Escalante-Alcalde et al., 2003 [PMID:12925589] was generated from "I.M.A.G.E. Consortium Id clone 766619".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Escalante-Alcalde D; Hernandez L; Le Stunff H; Maeda R; Lee HS; Jr-Gang-Cheng; Sciorra VA; Daar I; Spiegel S; Morris AJ; Stewart CL, 2003 [PMID:12925589] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.00635] [ PMID:12925589] Escalante-Alcalde D, Hernandez L, Le Stunff H, Maeda R, Lee HS, Jr-Gang-Cheng VA, Sciorra VA, Daar I, Spiegel S, Morris AJ, Stewart CL 2003 The lipid phosphatase LPP3 regulates extra-embryonic vasculogenesis and axis patterning. Development (130):4623-37
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE