Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4854

Ctgf connective tissue growth factor ( MGI:95537)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4854 EMAGE:4854
Fig 1A. Copyright: This image is from Ivkovic S; Yoon BS; Popoff SN; Safadi FF; Libuda DE; Stephenson RC; Daluiski A; Lyons KM, Development 2003; 130(12):2779-91 [doi:10.1242/10.1242/dev.00505] and is displayed with the permission of The Company of Biologist Limited who owns the Copyright. [PMID:12736220] Fig 1B. Copyright: This image is from Ivkovic S; Yoon BS; Popoff SN; Safadi FF; Libuda DE; Stephenson RC; Daluiski A; Lyons KM, Development 2003; 130(12):2779-91 [doi:10.1242/10.1242/dev.00505] and is displayed with the permission of The Company of Biologist Limited who owns the Copyright. [PMID:12736220]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: ba, branchial arch; fp, floorplate; h, heart; np, nasal process. Fig1A is a lateral view, Fig1B is a dorsal view.
Expression Pattern Description
Spatial Annotation:
EMAGE:4854Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4854_wholemount_moderate_3D_1.wlz
4854_wholemount_weak_3D_1.wlz
4854_wholemount_notDetected_3D_1.wlz
4854_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4854_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
fronto-nasal process
detected detected
Ctgf mRNA was detected beginning at E9.5 in the nasal process.
2nd branchial arch
detected detected
regionalCtgf mRNA was detected beginning at E9.5 in the proximal regions of the second and third branchial arches.
3rd branchial arch
detected detected
regionalCtgf mRNA was detected beginning at E9.5 in the proximal regions of the second and third branchial arches.
heart
detected detected
neural tube
detected detected
nervous system
detected detected
Expression detected in "neuronal tissues"
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Ctgf probeA
Entity Detected:Ctgf, connective tissue growth factor ( MGI:95537)
Sequence:sense strand is shown

>Ctgf probeA
TCAGCCAGATCCACTCCAGCTCCGACCCCAGGAGACCGACCTCCTCCAGACGGCAGCAGCCCCAGCCCAG
CCGACAACCCCAGACGCCACCGCCTGGAGCGTCCAGACACCAACCTCCGCCCCTGTCCGAATCCAGGCTC
CGGCCGCGCCTCTCGTCGCCTCTGCACCCTGCTGTGCATCCTCCTACCGCGTCCCGATCATGCTCGCCTC
CGTCGCAGGTCCCATCAGCCTCGCCTTGGTGCTCCTCGCTCTCTGCACCCGGCCTGCTATGGGCCAGGAC
TGCAGCGCGCAATGTCAGTGCGCACGCGAAGCAGCGCCGCACTGCCCCGCCGGCGTGACTAGGTGCTGGA
CGGCTGCGGCTGCTGCGATGCTGCGCCAAGCAGCTGGGAGAACTGTGTACGGAGCGTGACCCCTGCGACC
CACACAAGGGCCTCTTCTGCGATTTCGGCTTCCCGCCAAGCGCAAGATCGGAGTGTGCACTGCAAAGATG
GTGCACCTGTGTCTTCGGTGGGTCGGTGTACGCAGCGGTGAGTCTTCTAAGCAG
Notes:The Ctgf probe used in this study by Ivkovic et al., 2003 [PMID:12736220] is described as "generated by subcloning a partial mouse cDNA IMAGE clone (ID 551901) into pBluescript (Stratagene), linearizing with EcoRI, and reverse transcribing with T7 polymerase."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Ivkovic S; Yoon BS; Popoff SN; Safadi FF; Libuda DE; Stephenson RC; Daluiski A; Lyons KM, 2003 [PMID:12736220] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/dev.00505] [ PMID:12736220] Ivkovic S, Yoon BS, Popoff SN, Safadi FF, Libuda DE, Stephenson RC, Daluiski A, Lyons KM 2003 Connective tissue growth factor coordinates chondrogenesis and angiogenesis during skeletal development. Development (130):2779-91
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE