Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4884

Pyy peptide YY ( MGI:99924)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4884 EMAGE:4884
Fig4N. [doi:10.1186/1471-213X-7-92] [PMID:17683524] Copyright: This image is from Hou J; Charters AM; Lee SC; Zhao Y; Wu MK; Jones SJ; Marra MA; Hoodless PA. BMC Dev Biol 2007;7:92, an open-access article distributed under the terms of the Creative Commons Attribution License Fig4M. [doi:10.1186/1471-213X-7-92] [PMID:17683524] Copyright: This image is from Hou J; Charters AM; Lee SC; Zhao Y; Wu MK; Jones SJ; Marra MA; Hoodless PA. BMC Dev Biol 2007;7:92, an open-access article distributed under the terms of the Creative Commons Attribution License

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
The E9.0 embryo is shown to give an example of the 'clean' expression pattern (restricted to the gut) that is seen in all samples in this study apart from the E9.5 embryo in Fig 4N.
Expression Pattern Description
Spatial Annotation:
EMAGE:4884Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4884_wholemount_possible_3D_1.wlz
4884_wholemount_notDetected_3D_1.wlz
4884_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4884_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foregut
detected detected
Expression is detected in the posterior foregut, extending to the midgut junction.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Pyy probeA
Entity Detected:Pyy, peptide YY ( MGI:99924)
Sequence:sense strand is shown

>Pyy probeA
TCCTGCTCATCTTGCTTCGGAAGCTGTAGCTGCTATGGTGGCGGTGCGCAGGCCTTGGCCCGTCACGGTC
GCAATGCTGCTAATCCTGCTCGCCTGTCTGGGAGCCCTGGTGGACGCCTACCCTGCCAAACCAGAGGCTC
CCGGCGAAGACGCCTCCCCGGAGGAGCTGAGCCGCTACTACGCCTCCCTGCGCCACTACCTCAACCTGGT
CACCCGGCAGCGGTATGGAAAAAGAGATGTCCCCGCAGCTCTGTTCTCCAAACTGCTCTTCACAGACGAC
AGCGACAGCGAGAACCTCCCCTTCAGGCCAGAAGGTTTGGACCAGTGGTGAAGACTCCCCCAAGGCCTCC
TGCGAGATGTGTTAACTACACCGACTTCACTTGCATGTTTGGTTTAAGAAGAGGGCACTTCATATCTCGG
TGTCTCGGACACCCAGACTGGAGGGCTGTGTGTGTTCA
nt 3 - nt 460 of NM_145435.1
Notes:The Pyy probe template used in this study by Hou et al., 2007 [PMID:17683524] was generated by RT-PCR amplification from total RNAs isolated from E8.0-E8.5 endoderm using the following primers: TCCTGCTCATCTTGCTTCGG and TGAACACACACAGCCCTCCAG.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Hou J; Charters AM; Lee SC; Zhao Y; Wu MK; Jones SJ; Marra MA; Hoodless PA. 2007 [PMID:17683524] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1186/1471-213X-7-92] [ PMID:17683524] Hou J, Charters AM, Lee SC, Zhao Y, Wu MK, Jones SJ, Marra MA, Hoodless PA 2007 A systematic screen for genes expressed in definitive endoderm by Serial Analysis of Gene Expression (SAGE). BMC Dev Biol (7):92
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE