Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4909

Ranbp1 RAN binding protein 1 ( MGI:96269)
TS16 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4909 EMAGE:4909 EMAGE:4909 EMAGE:4909 EMAGE:4909
Figure 2A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793] Figure 2B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793] Figure 2E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793] Figure 2F. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793] Figure 2G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793]
EMAGE:4909 EMAGE:4909 EMAGE:4909
Figure 2H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793] Figure 2I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793] Figure 2J. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00616-5] Mech Dev 111: 177-80 Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, "RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction." Copyright 2002. [PMID:11804793]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: Figure 2B is the sense control.
Expression Pattern Description
Spatial Annotation:
EMAGE:4909Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4909_wholemount_moderate_3D_1.wlz
4909_wholemount_possible_3D_1.wlz
4909_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4909_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
latero-nasal process mesenchyme
detected detected
branchial arch
detected detected
future hindbrain
detected detected
regionalExpression in limited domains within or adjacent to the hindbrain.
outflow tract
detected detected
regionalA concentrated stripe of RanBP1 is observed along the forming outflow tracts of the heart.
forelimb bud
detected detected
Diffuse expression is seen within the limb bud.
hindlimb bud
detected detected
Diffuse expression is seen within the limb bud.
arterial system
detected detected
regionalExpressed in the aortic arches.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Ranbp1 probeA
Entity Detected:Ranbp1, RAN binding protein 1 ( MGI:96269)
Sequence:sense strand is shown

>Ranbp1 probeA
GACCCCCAGTTCGAGCCAATAGTTTCTCTTCCCGAGCAAGAAATTAAAACGCTGGAGGAAGATGAAGAGG
AACTTTTTAAGATGCGTGCAAAGCTGTTCCGGTTTGCTTCAGAGAATGACCTCCCAGAATGGAAGGAGCG
AGGCACTGGAGATGTCAAGCTTCTGAAGCACAAGGAGAAAGGGACCATCCGCCTTCTTATGAGGAGGGAC
AAAACCTTGAAGATATGCGCCAACCACTATATTACACCAATGATGGAGCTGAAGCCGAATGCTGGCAGTG
ACCGAGCCTGGGTCTGGAATACCCACACCGACTTTGCTGACGAGTGCCCCAAGCCTGAGCTGCTCGCCAT
CCGCTTCCTAAATGCTGAGAATGCACAAAAGTTCAAAACAAAGTTTGAAGAATGCAGGAAAGAAATTGAA
GAGAGAGAAAAGAAAGGACCAGGCAAAAATGATAATGCCGAAAAGGTGGCCGAGAAGCTGGAA
nt 207 - nt 689 of NM_011239.1
Notes:The Ranbp1 probe template used in this study by Maynard et al., 2002 [PMID:11804793] was 483nt in length and generated by RT-PCR using the following primers: forward: 5'-gacccccagttcgagccaatagtt-3'; reverse: 5'-ttccagcttctcggccaccttttc-3'.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:ICR
Age:10.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Maynard TM; Haskell GT; Bhasin N; Lee JM; Gassman AA; Lieberman JA; LaMantia AS, 2002 [PMID:11804793] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00616-5] [ PMID:11804793] Maynard TM, Haskell GT, Bhasin N, Lee JM, Gassman AA, Lieberman JA, LaMantia AS 2002 RanBP1, a velocardiofacial/DiGeorge syndrome candidate gene, is expressed at sites of mesenchymal/epithelial induction. Mech Dev (111):177-80
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE