Type: | in situ hybridisation probe |
Identifier: | Runx2 probeB |
Entity Detected: | Runx2, runt related transcription factor 2 ( MGI:99829) |
Notes: | The Runx2 probe template used in this study by Stricker et al., 2002 [PMID:11969258] was "generated from 3' untranslated sequences showing minimal or no homology to the other Runx genes", "using primers F: GTGTTCTGTGGTCTCTGAG and R: GGCAAAAGCTTGCAGAACTC".
Editors note: the full 3'UTR sequences of mouse Runx2 are under-represented in the public sequence databases. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |