Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4938

Rwdd2b RWD domain containing 2B ( MGI:1858215)
TS17 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4938
Figure 5A. [doi:10.1006/geno.1999.6109] Orti R; Rachidi M; Vialard F; Toyama K; Lopes C; Taudien S; Rosenthal A; Yaspo ML; Sinet PM; Delabar JM, "Characterization of a novel gene, C21orf6, mapping to a critical region of chromosome 21q22.1 involved in the monosomy 21 phenotype and of its murine ortholog, orf5." Genomics 2000, 64: 203-10. [PMID:10729227]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: In this paper, the authors show a sense control embryo with no evidence of the widespread staining seen in the embryo hbridised with anti-sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:4938Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4938_wholemount_moderate_3D_1.wlz
4938_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4938_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
trunk somite
strong strong
Expressed strongly in vertebrae anlage.
branchial arch
strong strong
embryo
detected detected
regionalExpressed ubiquitously in embryo and strongly in vertebrae anlage.
limb
strong strong
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Rwdd2b probeA
Entity Detected:Rwdd2b, RWD domain containing 2B ( MGI:1858215)
Sequence:sense strand is shown

>Rwdd2b probeA
CTGAAAGATTGTATTGAGAAGAGGACAATGGAGGGGCGATCATCGCAAGTGTACTTTACGATCAATGTGA
GCCTGGACCTCTCTGAGGCAGCAGTGGTGACGTTTTCTTTGTCTTGCATTCTTCCCTTTAAA
Notes:The Rwdd2b (orf5) probe used in this study by Orti et al., 2000 [PMID:10729227] was synthesized from the "mouse cDNA clone IMAGE (GenBank GI 1436418)" referred to elsewhere in the paper. i.e. IMAGE:401442. Editors note: the authors sequenced the insert of IMAGE:401442 in its entirety and it was found to be 1757bp long, however this full sequence is unpublished.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Orti R; Rachidi M; Vialard F; Toyama K; Lopes C; Taudien S; Rosenthal A; Yaspo ML; Sinet PM; Delabar JM, 2000 [PMID:10729227] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/geno.1999.6109] [ PMID:10729227] Orti R, Rachidi M, Vialard F, Toyama K, Lopes C, Taudien S, Rosenthal A, Yaspo ML, Sinet PM, Delabar JM 2000 Characterization of a novel gene, C21orf6, mapping to a critical region of chromosome 21q22.1 involved in the monosomy 21 phenotype and of its murine ortholog, orf5. Genomics (64):203-10
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE