Type: | in situ hybridisation probe |
Identifier: | MGI:3716457 |
Entity Detected: | Fgd5, FYVE, RhoGEF and PH domain containing 5 ( MGI:2443369) |
Sequence: | sense strand is shown
>MGI:3716457
AAGGTCTGTGATGGCTGCTTCCGGGAGCTGAAGTTGAGGAATGGGCCTGTCCCAGGCTCCATGAGAGAGC
GTCCAGTCAGCAT
|
| nt 3702 - nt 3784 of NM_172731.2 |
Notes: | The Fgd5 probe used in this study by Narumiya et al., 2007 [PMID:17462595] is described as follows: cDNA fragments were generated by PCR amplification using total cDNA from EBs (embryoid bodies) and cloned into pBlueScript SKII+ (Stratagene) or pCR4-TOPO (Invitrogen). The primers used were fwd - AAGGTCTGTGATGGCTGCTT and rev - ATGCTGACTGGACGCTCTCT . Hybridization was performed using mouse embryos under standard conditions. |
Chemistry: | RNA |
Strand: | antisense |