Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4957

Pcgf5 polycomb group ring finger 5 ( MGI:1923505)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:4957 EMAGE:4957 EMAGE:4957
Supplementary FigF1. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.bbrc.2007.04.030] Biochem Biophys Res Commun 357: 896-902, Narumiya H; Hidaka K; Shirai M; Terami H; Aburatani H; Morisaki T, Endocardiogenesis in embryoid bodies: novel markers identified by gene expression profiling. Copyright 2007 Supplementary FigF2. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.bbrc.2007.04.030] Biochem Biophys Res Commun 357: 896-902, Narumiya H; Hidaka K; Shirai M; Terami H; Aburatani H; Morisaki T, Endocardiogenesis in embryoid bodies: novel markers identified by gene expression profiling. Copyright 2007 Supplementary FigF3/4. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.bbrc.2007.04.030] Biochem Biophys Res Commun 357: 896-902, Narumiya H; Hidaka K; Shirai M; Terami H; Aburatani H; Morisaki T, Endocardiogenesis in embryoid bodies: novel markers identified by gene expression profiling. Copyright 2007

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
From left to right, left and right view of whole embryo, left and right view of heart region. Image annotations: OFT - out flow tract, a - atrium, LV - left ventricle, RV - right ventricle, ph - pharyngeal arch.
Expression Pattern Description
Spatial Annotation:
EMAGE:4957Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4957_wholemount_moderate_3D_1.wlz
4957_wholemount_weak_3D_1.wlz
4957_wholemount_notDetected_3D_1.wlz
4957_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4957_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
heart
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3716459
Entity Detected:Pcgf5, polycomb group ring finger 5 ( MGI:1923505)
Sequence:sense strand is shown

>MGI:3716459
AAGGCTGGATAACACGTTGGAGGAAATTATCTTTAAATTAGTGCCTGGACTACGAGAACAAGAACTTCAG
CGTGAGTTGGAATTTTGGAAGAAAAACAAACCTCAAGAAAATGGGCAAGA
nt 469 - nt 588 of NM_029508.3
Notes:The Pcgf5 probe used in this study by Narumiya et al., 2007 [PMID:17462595] is described as follows: cDNA fragments were generated by PCR amplification using total cDNA from EBs (embryoid bodies) and cloned into pBlueScript SKII+ (Stratagene) or pCR4-TOPO (Invitrogen). The primers used were fwd - AAG GCT GGA TAA CAC GTT GG and rev - TCT TGC CCA TTT TCT TGA GG. Hybridization was performed using mouse embryos under standard conditions.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Narumiya H; Hidaka K; Shirai M; Terami H; Aburatani H; Morisaki T, 2007 [PMID:17462595] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1016/j.bbrc.2007.04.030] [ PMID:17462595] Narumiya H, Hidaka K, Shirai M, Terami H, Aburatani H, Morisaki T 2007 Endocardiogenesis in embryoid bodies: novel markers identified by gene expression profiling. Biochem Biophys Res Commun (357):896-902
Links:MGI:3716536 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI