Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4960

Casp3 caspase 3 ( MGI:107739)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:4960 EMAGE:4960
Fig2A. [doi:10.1006/bbrc.1996.6002] Reprinted from Biochem Biophys Res Comm, vol 231, Mukasa T; Urase K; Momoi MY; Kimura I; Momoi T, “Specific Expression of CPP32 in Sensory Neurons of Mouse Embryos and Activation of CPP32 in the Apoptosis Induced by a Withdrawal of NGF”, pp 770-774, Copyright (1997) with permission from Elsevier. [PMID:9070890] Fig2B. [doi:10.1006/bbrc.1996.6002] Reprinted from Biochem Biophys Res Comm, vol 231, Mukasa T; Urase K; Momoi MY; Kimura I; Momoi T, “Specific Expression of CPP32 in Sensory Neurons of Mouse Embryos and Activation of CPP32 in the Apoptosis Induced by a Withdrawal of NGF”, pp 770-774, Copyright (1997) with permission from Elsevier. [PMID:9070890]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrows indicate trigeminal (V) ganglia and facio-acoustic (VII-VIII) ganglion complex. Arrowheads indicate dorsal root ganglia. Fig2a shows an embryo hybridized with the anti-sense probe, Fig2b shows an embryo hybridized with the sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:4960Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4960_wholemount_moderate_3D_1.wlz
4960_wholemount_notDetected_3D_1.wlz
4960_wholemount_strong_3D_1.wlz
4960_wholemount_possible_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4960_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
weak weak
The expression of CPP32 was at low level in motor neurons and central nervous system of 10.5-day mouse embryos.
peripheral nervous system
weak weak
regionalThe expression of CPP32 was at low level in motor neurons and central nervous system of 10.5-day mouse embryos.
trigeminal v ganglion
strong strong
Trigeminal (V) ganglia and facio-acoustic (VII-VIII) ganglion complex were strongly positive.
facial vii ganglion
strong strong
Trigeminal (V) ganglia and facio-acoustic (VII-VIII) ganglion complex were strongly positive.
acoustic viii ganglion
strong strong
Trigeminal (V) ganglia and facio-acoustic (VII-VIII) ganglion complex were strongly positive.
dorsal root ganglion
strong strong
DRGs were strongly positive.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Casp3 probeA
Entity Detected:Casp3, caspase 3 ( MGI:107739)
Sequence:sense strand is shown

>Casp3 probeA
TGCTGGTGGGATCAAAGCGCAGTGTCCTGCGGCGGGGAGCTTGGAACGCTAAGAAAAGTGACCATGGAGA
ACAACAAAACCTCAGTGGATTCAAAATCCATTAATAATTTTGAAGTAAAGACCATACATGGGAGCAAGTC
AGTGGACTCTGGGATCTATCTGGACAGTAGTTACAAAATGGATTATCCTGAAATGGGCATATGCATAATA
ATTAATAATAAGAACTTCCATAAGAGCACTGGAATGTCATCTCGCTCTGGTACGGATGTGGACGCAGCCA
ACCTCAGAGAGACATTCATGGGCCTGAAATACCAAGTCAGGAATAAAAATGATCTTACTCGTGAAGACAT
TTTGGAATTAATGGATAGTGTTTCTAAGGAAGATCATAGCAAAAGGAGCAGCTTTGTGTGTGTGATTCTA
AGCCATGGTGATGAAGGGGTCATTTATGGGACAAATGGGCCTGTTGAACTGAAAAAGTTGACTAGCTTCT
TCAGAGGCGACTACTGCCGGAGTCTGACTGGAAAGCCGAAACTCTTCATCATTCAGGCCTGCCGGGGTAC
GGAGCTGGACTGTGGCATTGAGACAGACAGTGGGACTGATGAGGAGATGGCTTGCCAGAAGATACCGGTG
GAGGCTGACTTCCTGTATGCTTACTCTACAGCACCTGGTTACTATTCCTGGAGAAATTCAAAGGACGGGT
CGTGGTTCATCCAGTCCCTTTGCAGCATGCTGAAGCTGTACGCGCACAAGCTAGAATTTATGCACATTCT
CACTCGCGTTAACAGGAAGGTGGCAACG
nt 1 - nt 798 of NM_009810.2
Notes:The Casp3 (CPP32) probe used in this study by Mukasa et al., 1997 [PMID:9070890] is described as follows, "Sense and anti-sense digoxigenin-labeled RNA probes of mouse CPP32 were transcribed from linearized SK+ plasmid containing EcoRI fragment (798 bp) of 5' portion of mouse CPP32 by T7 RNA polymerase in vitro according to the manufacturer's manual." Editors note: EcoRI cuts the mouse Casp3 cDNA RefSeq NM_009810.2 (1466nt) once, at nt position 798. It is therefore assumed that the fragment described by the authors covers the entire 5' sequence to this EcoRI site.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase
General Information
Authors:Mukasa T; Urase K; Momoi MY; Kimura I; Momoi T, 1997 [PMID:9070890] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/bbrc.1996.6002] [ PMID:9070890] Mukasa T, Urase K, Momoi MY, Kimura I, Momoi T 1997 Specific expression of CPP32 in sensory neurons of mouse embryos and activation of CPP32 in the apoptosis induced by a withdrawal of NGF. Biochem Biophys Res Commun (231):770-4
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE