Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:4990

Dicer1 Dicer1, Dcr-1 homolog (Drosophila) ( MGI:2177178)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:4990 EMAGE:4990
Figure 1I embryo. [doi:10.1016/j.bbrc.2005.05.206] Reprinted from Biochem Biophys Res Comm, vol 334, Lu J; Qian J; Chen F; Tang X; Li C; Cardoso WV, “Differential expression of components of the microRNA machinery during mouse organogenesis”, pp 319-23, Copyright (2005) with permission from Elsevier. [PMID:16036130] Figure 1I trunk. [doi:10.1016/j.bbrc.2005.05.206] Reprinted from Biochem Biophys Res Comm, vol 334, Lu J; Qian J; Chen F; Tang X; Li C; Cardoso WV, “Differential expression of components of the microRNA machinery during mouse organogenesis”, pp 319-23, Copyright (2005) with permission from Elsevier. [PMID:16036130]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: left panel = whole embryo; right panel = neural tube (nt), dorsal root ganglia (drg), and somites (so); arrowheads indicate presence of signal.
Expression Pattern Description
Spatial Annotation:
EMAGE:4990Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
4990_wholemount_moderate.wlz
4990_wholemount_weak.wlz
4990_wholemount_notDetected.wlz
4990_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:4990_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
limb
detected detected
Dicer1 was present in the E11.5 limb bud.
trunk somite
detected detected
dorsal root ganglion
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3587203
Entity Detected:Dicer1, Dicer1, Dcr-1 homolog (Drosophila) ( MGI:2177178)
Sequence:sense strand is shown

>MGI:3587203
TCCGATGATGCAGCCTCTAATAGAAAAGTTTTCTGCAAATGTGCCTCGTTCTCCAGTGAGAGAATTGCTC
GAGATGGAACCAGAAACTGCCAAGTTTAGCCCAGCGGAGAGAACTTATGATGGAAAGGTCAGAGTCACCG
TGGAAGTGGTGGGAAAGGGGAAATTTAAAGGTGTTGGCCGGAGCTACAGGATCGCCAAGTCTGCTGCAGC
ACGAAGGGCCCTCCGCAGCCTCAAAGCTAACCAGCCTCAGGTTCCTAACAGCTGAAGCTTCCGGACTCAC
AGGCGGCAAGACAGCGGACCAGAACCACAGCTCCACGGCACAAGGATGGTTCGGGCTGACACAGAACAG
nt 5736 - nt 6084 of NM_148948.2
Notes:The Dicer1 probe template used in this study by Lu et al., 2005 [PMID:16036130] is described as follows: "The DNA template for the labeling of RNA probes were generated by PCR, using GenBank sequence Dicer1, NM_148948. The primers containing T7 or T3 promoters sequences used to generate the DNA template for probe were: 5' primer: AATTAACCCTCACTAAAGGGTCCGATGATGCAGCCTCTAA 3' primer: TAATACGACTCACTATAGGGCTGTTCTCTCTCAGCCCGAA ."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Lu J; Qian J; Chen F; Tang X; Li C; Cardoso WV, 2005 [PMID:16036130] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.bbrc.2005.05.206] [ PMID:16036130] Lu J, Qian J, Chen F, Tang X, Li C, Cardoso WV 2005 Differential expression of components of the microRNA machinery during mouse organogenesis. Biochem Biophys Res Commun (2005):319-23
Links:MGI:3587211 same experiment
 MGI:3587198 primer sequences
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI