Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5022

Dusp9 dual specificity phosphatase 9 ( MGI:2387107)
TS18 (11.0 dpc)
in situ hybridisation

Data Images
EMAGE:5022
Fig8(E11.0). from Biochemical J 2002 364(1): 145-55, Dickinson RJ; Williams DJ; Slack DN; Williamson J; Seternes OM; Keyse SM, Characterization of a murine gene encoding a developmentally regulated cytoplasmic dual-specificity mitogen-activated protein kinase phosphatase. Copyright 2002 [PMID:11988087]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5022Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5022_wholemount_moderate_3D_1.wlz
5022_wholemount_weak_3D_1.wlz
5022_wholemount_notDetected_3D_1.wlz
5022_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5022_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
liver
strong strong
hindlimb bud
detected detected
regionalExpression is limited to a group of ventral muscle cells in the hind-limbs.
oral region
detected detected
regionalExpression of Pyst3 is evident from E9 in the face, expanding from a group of cells in the mandible at E10 to occupy locations around the oral cavity comprising musculature derived from the hypoglossal cord by E11.
embryo
detected detected
regionalExpression of Pyst3 is evident from E9 in the face, expanding from a group of cells in the mandible at E10 to occupy locations around the oral cavity comprising musculature derived from the hypoglossal cord by E11.
1st branchial arch mandibular component
detected detected
Expression of Pyst3 is evident from E9 in the face, expanding from a group of cells in the mandible at E10 to occupy locations around the oral cavity comprising musculature derived from the hypoglossal cord by E11.
telencephalon
detected detected
regionalAt E11, expression is also detected in the ventral telencephalon, and additionally in a punctate central domain at the base of the mid-line separating the telencephalic hemispheres.
brain
detected detected
regionalAt E11, expression is also detected in the ventral telencephalon, and additionally in a punctate central domain at the base of the mid-line separating the telencephalic hemispheres.
forelimb bud
not detected not detected
homogeneousForelimb expression is lost entirely by this stage.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Dusp9 probeB
Entity Detected:Dusp9, dual specificity phosphatase 9 ( MGI:2387107)
Sequence:sense strand is shown

>Dusp9 probeB
TCTAGAGCGGGGCCATGCTCCAGAACCTGCCTCGTCTGTGACTGTTACTTTCTTTTTTCAGGGTGGGAGT
GGGGCTTCCTATCCAAGAGACCATTCCAGATTGCTGCCTGGGCCCTGGCCCTTCTTGCTGTTTCATTTTC
AGGAAGAGTGTATCATTCTTTGCCACAGGAACCTGCTCTTGGCTCCATACCTGTCCCCGAATGCCCACCT
GTGGGAGCAGACCTGGCCACTTTGACTCGTGTAGACTCCTTCCTGCTTCTCTCACTAGGGCTTAGACTTC
TTGGAACTGTAGGGTGTGAACCCAGAGACACAATGGCTGCTCTCCGCATCCACAGGGACAGCCTCTCTGG
GTGGCTTTTTGCTGGGCAGTGTCACATGGGAGGGCATGGGCCTGGGAGCCAATGGGCGAGATCCCAGCCA
CACATCTGGTGCCCTGACTGTTTCTTTCCTCCTCCCCCAGATGTCTTGACAGGATCACTGAGACTCTTTG
TGACTGAGGGTGGTCAAACTGCCACCGGAGGAGATAGGGTCTCAGAGCTAGAGCTGAGGGGGAGGGAGGG
AAAGATGAAGGCCTCAATTTTGCTACTGTGAGTCTCACACAGCCACTGTTGGTTTGGGGGGCAGGGAAGG
GGCCAAGCTGCA
nt 1839 - nt 2480 of NM_029352.3
Notes:The Dusp9 (Pyst3) probe used in this study by Dickinson et al., 2002 [PMID:11988087] is described as a "digoxigenin-labelled cRNA probe, generated by run-off transcription with T7 polymerase from a pBluescript construct containing a 635bp XbaI-PstI restriction fragment derived from the 3'UTR of Pyst3."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:11.0 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Dickinson RJ; Williams DJ; Slack DN; Williamson J; Seternes OM; Keyse SM, 2002 [PMID:11988087] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11988087] Dickinson RJ, Williams DJ, Slack DN, Williamson J, Seternes OM, Keyse SM 2002 Characterization of a murine gene encoding a developmentally regulated cytoplasmic dual-specificity mitogen-activated protein kinase phosphatase. Biochem J (364):145-55
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE