Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5073

Dvl3 dishevelled 3, dsh homolog (Drosophila) ( MGI:108100)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5073 EMAGE:5073
Fig6d(left). Copyright: This image is from [doi:10.1002/(SICI)1097-0177(199611)207:3<253::AID-AJA2>3.0.CO;2-G] Tsang M; Lijam N; Yang Y; Beier DR; Wynshaw-Boris A; Sussman DJ, "Isolation and characterization of mouse dishevelled-3." Dev Dyn 1996 Nov;207(3):253-62. Reprinted with permission of Wiley-Liss Inc. [PMID:8922524] . Fig6d(right). Copyright: This image is from [doi:10.1002/(SICI)1097-0177(199611)207:3<253::AID-AJA2>3.0.CO;2-G] Tsang M; Lijam N; Yang Y; Beier DR; Wynshaw-Boris A; Sussman DJ, "Isolation and characterization of mouse dishevelled-3." Dev Dyn 1996 Nov;207(3):253-62. Reprinted with permission of Wiley-Liss Inc. [PMID:8922524] .

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: s, somites; b, branchial arches; I, limb buds; drg, dorsal root ganglia. Fig6D(left) shows an embryo hybridised with the antisense probe; Fig6D(right) shows an embryo hybridised with the sense probe. Positive controls using brachyury (T) and lim-1 (Lhx1) antisense transcripts were performed to show that the hybridisation conditions yielded specific signals for the Dvl3 probe (data not shown).
Expression Pattern Description
Spatial Annotation:
EMAGE:5073Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5073_wholemount_moderate.wlz
5073_wholemount_weak.wlz
5073_wholemount_strong.wlz
5073_wholemount_possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5073_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
detected detected
heart
detected detected
branchial arch
detected detected
limb
detected detected
gradedExpression of Dvl3 in the limb bud appears to be non-uniform, with slightly higher levels occurring in distal and dorsal regions, as well as in the surface ectoderm.
notochord
detected detected
trunk somite
detected detected
brain
detected detected
future spinal cord
detected detected
forelimb bud ectoderm
detected detected
hindlimb bud ectoderm
detected detected
hindlimb bud
detected detected
regionalExpression of Dvl3 in the limb bud appears to be non-uniform, with slightly higher levels occurring in distal and dorsal regions, as well as in the surface ectoderm.
forelimb bud
detected detected
regionalExpression of Dvl3 in the limb bud appears to be non-uniform, with slightly higher levels occurring in distal and dorsal regions, as well as in the surface ectoderm.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Dvl3 probeA
Entity Detected:Dvl3, dishevelled 3, dsh homolog (Drosophila) ( MGI:108100)
Sequence:sense strand is shown

>Dvl3 probeA
GCTAGCAACCTGCTGAAAGCTGGTTTCATCCGCCATACCGTCAACAAGATCACGTTCTCCGAGCAGTGCT
ACTACATCTTTGGCGACCTCTGTGGTAACATGGCCAACCTATCGCTTCACGACCATGATGGCTCCAGTGG
CGCCTCTGACCAGGACACACTGGCTCCTTTGCCGCACCCAGGAGCTGCCCCTTGGCCTATGGCTTTCCCT
TACCAGTACCCACCACCTCCGCATCCCTACAACCCACACCCAGGCTTCCCAGAACTGGGCTACAGCTACG
GTGGGGGCAGCGCCAGCAGTCAGCACAGTGAAGGCAGTCGGAGCAGTGGCTCCAACCGAAGTGGCAGCGA
CCGGCGCAAGGAGAAGGACCCAAAAGCTGGGGACTCCAAGTCAGGTGGTAGCGGCAGCGAGTCAGACCAC
ACTACACGCAGCAGTCTGAGGGGGCCACGGGAGCGGGCACCAAGCGAGCGATCAGGCCCAGCGGCCAGCG
AGCACAGCCACCGCAGTCACCATTCGCTGACCAGCAGCCTGCGCAGCCACCACACACACCCAAGCTATGG
CCCACCCGGAGTGCCCCCTCTCTATGGTCCCCCGATGCTGATGATGACCCCGCCGCCGGCAGCCATGGGT
CCCCCAGGAGCCCCTCCAGGGCGTGACCTGGCCTCGGTGCCCCCGGAACTGACGGCCAGCAGACAGTCCT
TCCGCATGGCAATGGGAAACCCCAGTGAGTTCTTTGTGGATGTGATGTGATCAGGGCCCCTCTCCAGCTC
TTACCTCTCAGCCGGCTGCACCCCCATCTCCATCAGTCGGCCTTTTTTTTTTTTTTTCCTTTTTTTTAAA
AACACTTTGGTAC
nt 1533 - nt 2385 of NM_007889.2
Notes:The Dvl3 probe used in this study by Tsang et al., 1996 [PMID:8922524] is described as follows "A NheI/KpnI (bases 1,621-2,468) fragment from the Dvl3 cDNA was cloned into the XbI/KpnI sites of the pKS vector (Stratagene). Strand specific RNA probes were synthesized using T7 (sense) and T3 (antisense) RNA polymerase and labelled with digoxigenin UTP (Genius, Boehringer-Mannheim)." Editors note: See Fig1 of Tsang et al., 1996 for the sequence referred to (this sequence was not submitted to GenBank). When the mouse Dvl3 cDNA RefSeq is digested with NheI/KpnI, the resulting fragment is approximately the same size as the fragment described by Tsang et al (i.e. within 10nt in length).
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Tsang M; Lijam N; Yang Y; Beier DR; Wynshaw-Boris A; Sussman DJ, 1996 [PMID:8922524] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/(SICI)1097-0177(199611)207:3<253::AID-AJA2>3.0.CO;2-G] [ PMID:8922524] Tsang M, Lijam N, Yang Y, Beier DR, Wynshaw-Boris A, Sussman DJ 1996 Isolation and characterization of mouse dishevelled-3. Dev Dyn (207):253-62
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE