Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5075

Dyrk1a dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a ( MGI:1330299)
TS18 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5075 EMAGE:5075
Fig2E. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.2002.0675] Dev Biol 246(2): 259-73, Hammerle B; Vera-Samper E; Speicher S; Arencibia R; Martinez S; Tejedor FJ, Mnb/Dyrk1A is transiently expressed and asymmetrically segregated in neural progenitor cells at the transition to neurogenic divisions. Copyright 2002 [PMID:12051815] Fig2D. Copyright: Reprinted with permission from Elsevier from [doi:10.1006/dbio.2002.0675] Dev Biol 246(2): 259-73, Hammerle B; Vera-Samper E; Speicher S; Arencibia R; Martinez S; Tejedor FJ, Mnb/Dyrk1A is transiently expressed and asymmetrically segregated in neural progenitor cells at the transition to neurogenic divisions. Copyright 2002 [PMID:12051815]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: ac, apical crest; e, eye; nc, neural crest; ov, otic vesicle; V, X, IX, VII/VIII, placodes-ganglia of cranial nerves. NOTE: Fig2E shows a mouse embryo probed for mouse-Dyrk1a. Fig2D is included as a supporting image - it shows a chicken embryo probed with the chick sequence to detect expression of the chick orthologue.
Expression Pattern Description
Spatial Annotation:
EMAGE:5075Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5075_wholemount_moderate.wlz
5075_wholemount_possible.wlz
5075_wholemount_notDetected.wlz
5075_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5075_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionalMnb expression is clearly observed in the areas of migrating neural crest cells.
cranial ganglion
detected detected
regionalMnb is also expressed in other non-CNS proliferating cells, such as cranial placodes.
otocyst
detected detected
Mnb is also expressed in other non-CNS proliferating cells, such as the otic vesicle.
nose
detected detected
Mnb is also expressed in other non-CNS proliferating cells, such as nasal placode.
cornea epithelium
detected detected
eye
detected detected
regionalMnb is also expressed in nonneural tissue, such as lens placode.
forelimb bud apical ectodermal ridge
detected detected
hindlimb bud apical ectodermal ridge
detected detected
oral region
detected detected
regionalMnb is also expressed in nonneural tissue, such as oral plate.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Dyrk1a probeA
Entity Detected:Dyrk1a, dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a ( MGI:1330299)
Sequence:sense strand is shown

>Dyrk1a probeA
GAGGTTTACTATGCAAAAAAGAAGCGAAGACACCAACAGGGCCAGGGGGACGATTCCAGTCATAAGAAGG
AGCGGAAGGTTTACAATGATGGTTACGATGATGATAACTATGATTATATTGTAAAAAACGGGGAAAAGTG
GATGGATCGGTATGAAATCGACTCCTTAATAGGCAAAGGTTCATTTGGACAGGTTGTGAAAGCTTATGAC
AGAGTGGAGCAAGAATGGGTCGCCATTAAAATCATCAAGAACAAGAAAGCGTTTCTGAATCAAGCCCAGA
TAGAAGTGCGGCTGCTTGAGCTC
nt 360 - nt 662 of U58497.1
Notes:The Dyrk1a (Mnb) probe used in this study by Hammerle et al., 2002 [PMID:12051815] is described as follows, "In the case of mouse Mnb, the template was a 302-bp fragment (bp 360-662; EMBL database, Accession No.U58497)."
Chemistry:RNA
Strand:antisense
Label:digoxigenin or fluorescein
Specimen
Organism:mouse
Strain:ICR
Age:10.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + unspecified
General Information
Authors:Hammerle B; Vera-Samper E; Speicher S; Arencibia R; Martinez S; Tejedor FJ, 2002 [PMID:12051815] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/dbio.2002.0675] [ PMID:12051815] Hommerle B, Vera-Samper E, Speicher S, Arencibia R, Martinez S, Tejedor FJ 2002 Mnb/Dyrk1A is transiently expressed and asymmetrically segregated in neural progenitor cells at the transition to neurogenic divisions. Dev Biol (2002):259-73
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE