Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5085

Sostdc1 sclerostin domain containing 1 ( MGI:1913292)
TS19 (11.0 dpc)
in situ hybridisation

Data Images
EMAGE:5085 EMAGE:5085
Fig5A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2003.08.011] Dev Biol 264: 91-105, Laurikkala J; Kassai Y; Pakkasjarvi L; Thesleff I; Itoh N. Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, and SHH signals from the tooth enamel knot. Copyright 2003 [PMID:14623234] Fig5B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.ydbio.2003.08.011] Dev Biol 264: 91-105, Laurikkala J; Kassai Y; Pakkasjarvi L; Thesleff I; Itoh N. Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, and SHH signals from the tooth enamel knot. Copyright 2003 [PMID:14623234]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
(A) E11 mouse embryo showing expression on the surface of the branchial arches and in limb buds. (B) Frontal view of E11 head shows staining at the surface of facial processes.
Expression Pattern Description
Spatial Annotation:
EMAGE:5085Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5085_wholemount_moderate.wlz
5085_wholemount_weak.wlz
5085_wholemount_possible.wlz
5085_wholemount_notDetected.wlz
5085_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5085_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionaldiffuse staining was seen throughout the surface of the embryo
mandibular process
strong strong
Expression was most intense in the head region on the surfaces of the mandibular, maxillary, and frontonasal processes (Fig. 5A and B). Analysis of tissue sections indicated that transcripts were present both in the epithelium and the mesenchyme (not shown).
maxillary process
strong strong
Expression was most intense in the head region on the surfaces of the mandibular, maxillary, and frontonasal processes (Fig. 5A and B). Analysis of tissue sections indicated that transcripts were present both in the epithelium and the mesenchyme (not shown).
maxillary process mesenchyme
detected detected
mandibular process mesenchyme
detected detected
fronto-nasal process
strong strong
Expression was most intense in the head region on the surfaces of the mandibular, maxillary, and frontonasal processes (Fig. 5A and B). Analysis of tissue sections indicated that transcripts were present both in the epithelium and the mesenchyme (not shown).
limb
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Sostdc1 probeA
Entity Detected:Sostdc1, sclerostin domain containing 1 ( MGI:1913292)
Sequence:sense strand is shown

>Sostdc1 probeA
ATGCTTCCTCCTGCCATTCATCTCTCTCTCATTCCCCTGCTCTGCATCCTGATGAGAAACTGTTTGGCTT
TTAAAAATGATGCCACAGAAATCCTTTATTCACATGTGGTTAAACCTGTCCCGGCACACCCCAGCAGCAA
CAGCACCCTGAATCAAGCCAGGAATGGAGGCAGGCATTTCAGTAGCACTGGACTGGATCGAAACAGTCGA
GTTCAAGTGGGCTGCAGGGAACTGCGGTCCACCAAATACATTTCGGACGGCCAGTGCACCAGCATCAGCC
CTCTGAAGGAGCTGGTGTGCGCGGGCGAGTGCTTGCCCCTGCCGGTGCTTCCCAACTGGATCGGAGGAGG
CTATGGAACAAAGTACTGGAGCCGGAGGAGCTCTCAGGAGTGGCGGTGTGTCAACGACAAGACGCGCACC
CAGAGGATCCAGCTGCAGTGTCAGGACGGCAGCACGCGCACCTACAAAATCACCGTGGTCACGGCGTGCA
AGTGCAAGAGGTACACCCGTCAGCACAACGAGTCCAGCCACAACTTTGAAAGCGTGTCGCCCGCCAAGCC
CGCCCAGCACCACAGAGAGCGGAAGAGAGCCAGCAAATCCAGCAAGCACAGTCTGAGCTAG
nt 1 - nt 621 of AB059271.1
Notes:The Sostdc1 probe template used in this study by Laurikkala et al., 2003. [PMID:14623234] is described as "a 657-bp fragment (nucleotides 1-657) inserted into pGEM-T vector". Editors Note: The authors isolated a "full-length cDNA" (GenBank Accession No. AB059271), however AB059271.1 is 621nt in length.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:11.0 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Laurikkala J; Kassai Y; Pakkasjarvi L; Thesleff I; Itoh N, 2003. [PMID:14623234] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.ydbio.2003.08.011] [ PMID:14623234] Laurikkala J, Kassai Y, Pakkasjarvi L, Thesleff I, Itoh N 2003 Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, and SHH signals from the tooth enamel knot. Dev Biol (264):91-105
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE