Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5091

Sox17 SRY-box containing gene 17 ( MGI:107543)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5091
Fig1C [doi:10.1242/jcs.03081] Matsui T; Kanai-Azuma M; Hara K; Matoba S; Hiramatsu R; Kawakami H; Kurohmaru M; Koopman P; Kanai Y "Redundant roles of Sox17 and Sox18 in postnatal angiogenesis in mice." 2006 J Cell Sci 119:3513-26. [PMID:16895970]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5091Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5091_wholemount_moderate_3D_1.wlz
5091_wholemount_possible_3D_1.wlz
5091_wholemount_notDetected_3D_1.wlz
5091_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5091_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hindgut epithelium
not detected not detected
homogeneousAfter E9.5, Sox17 expression was no longer detectable in the hindgut endoderm
dorsal aorta
detected detected
regionalSox17 expression is clearly found in the vascular endothelial cells of the dorsal aortae.
arterial system
detected detected
regionalSox17 expression is clearly found in the developing inter-somitic blood vessels.
venous system
detected detected
regionalSox17 expression is clearly found in the developing inter-somitic blood vessels.
gallbladder primordium
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:32026
Entity Detected:Sox17, SRY-box containing gene 17 ( MGI:107543)
Sequence:sense strand is shown

>MGI:32026
GGCTAGCTTCCGATCCCTGCCTCAGGGTCGGGGGAAGCGGCGTGTCCCGTGGCCATAGCAGAGCTCGGGG
TCGGTCTGGAGAGCCATGAGCAGCCCGGATGCGGGATACGCCAGTGACGACCAGAGCCAGCCCCGGAGCG
CGCAGCCCGCGGTGATGGCAGGGTTGGGCCCCTGTCCCTGGGCCGAGTCCCTGAGCCCCCTCGGGGATGT
AAAGGTGAAAGGCGAGGTGGTGGCGAGTAGCGGGGCGCCAGCCGGGACGTCGGGCCGAGCCAAAGCGGAG
TCTCGCATCCGGCGGCCGAT
nt 165 - nt 464 of D49474.1
Notes:The Sox17 probe used in this study by Matsui et al., 2006 [PMID:11973269] 16895970} is indicated as that used by Kanai-Azuma et al., 2002 [PMID:8636240] who in turn refer to Kanai et al., 1996 [PMID:null] who describe a Sox17-specific probe that was used for in situ hybridisations: "(+564 to +863; probeC". Editors note: the nucleotide numbering refers to the sequence shown in Fig1 of Kanai et al, which equates to nt 165-464 of the accompanying GenBank entry D49474.1.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Matsui T; Kanai-Azuma M; Hara K; Matoba S; Hiramatsu R; Kawakami H; Kurohmaru M; Koopman P; Kanai Y. 2006. [PMID:16895970] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1242/jcs.03081] [ PMID:16895970] Matsui T, Kanai-Azuma M, Hara K, Matoba S, Hiramatsu R, Kawakami H, Kurohmaru M, Koopman P, Kanai Y 2006 Redundant roles of Sox17 and Sox18 in postnatal angiogenesis in mice. J Cell Sci (119):3513-26
 [ PMID:11973269] Kanai-Azuma M, Kanai Y, Gad JM, Tajima Y, Taya C, Kurohmaru M, Sanai Y, Yonekawa H, Yazaki K, Tam PP, Hayashi Y 2002 Depletion of definitive gut endoderm in Sox17-null mutant mice. Development (129):2367-79
 [ doi:10.1083/jcb.133.3.667] [ PMID:8636240] Kanai Y, Kanai-Azuma M, Noce T, Saido TC, Shiroishi T, Hayashi Y, Yazaki K 1996 Identification of two Sox17 messenger RNA isoforms, with and without the high mobility group box region, and their differential expression in mouse spermatogenesis. J Cell Biol (133):667-81
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE