| Type: | in situ hybridisation probe |
| Identifier: | Sufu probeA |
| Entity Detected: | Sufu, suppressor of fused homolog (Drosophila) ( MGI:1345643) |
| Sequence: | sense strand is shown
>Sufu probeA
GGAGAGTGTCGCCGCCTCTACCCTGACCAGCCGAACCCGCTCCAGGTTACCGCTATCGTCAAGTACTGGT
TGGGTGGTCCGGACCCCTTGGACTATGTTAGCATGTACAGGAACATGGGGAGTCCTTCTGCCAACATCCC
TGAGCACTGGCACTACATCAGCTTTGGCCTGAGTGATCTCTATGGTGACAACAGAGTCCATGAGTTTACA
GGAACAGACGGACCAAGTGGATTTGGCTTTGAGTTGACGTTTCGTCTGAAGAGAGAAACTGGGGAGTCTG
CCCCACCAACATGGCCAGCAGAGCTGATGCAGGGCCTAGCCCGATATGTCTTCCAGTCAGAGAACACCTT
CTGTAGCGGGGACCATGTGTCTTGGCACAGCCCTTTGGATAACAGTGAGTCAAG
|
| | nt 1 - nt 404 of AJ308625.1 |
| Notes: | The Sufu probe used in this study by Pearse et al., 1999 [PMID:10433824] is described as follows "the 420-bp EcoRI fragment from the mouse EST was used in run-off transcription reactions to generate digoxigenin-11 UTP-labeled riboprobes (Boehringer Mannheim)".
Editors note: The authors state elsewhere "The EST clone ID 513730 (GenBank Accession No. AA061391) was obtained from Genome Systems, Inc. This clone was originally isolated from a mouse testis cDNA library and contains an insert of approximately 950 bp." Restriction analysis of the full insert of IMAGE:513730 (AJ308625.1; 987nt) with EcoRI identifies a single cut site at nt404, which would result in two fragments: 404nt (5' fragment) and 583nt (3' fragment) in length. The following 5' adaptor sequence: 5'-GAATTCGGCACGAG-3' (which contains an EcoRI site) was used in the cloning of IMAGE:513730 (info obtained from AA061391 GenBank entry), therefore the 420-bp EcoRI fragment from the mouse EST described by the authors contains the linker sequence and sequence extending from nt1-404 of AJ308625.1. |
| Chemistry: | RNA |
| Strand: | antisense |
| Label: | digoxigenin |
icon to keep this page displayed.)
