Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5117

Sulf1 sulfatase 1 ( MGI:2138563)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5117 EMAGE:5117
FigS2-B. [doi:10.1371/journal.pone.0000575] [PMID:17593974] Copyright: This image is from Holst CR; Bou-Reslan H; Gore BB; Wong K; Grant D; Chalasani S; Carano RA; Frantz GD; Tessier-Lavigne M; Bolon B; French DM; Ashkenazi A. Secreted Sulfatases Sulf1 and Sulf2 Have Overlapping yet Essential Roles in Mouse Neonatal Survival. PLoS ONE 2007 2(6):e575, an open-access article distributed under the terms of the Creative Commons Attribution License FigS2-G. [doi:10.1371/journal.pone.0000575] [PMID:17593974] Copyright: This image is from Holst CR; Bou-Reslan H; Gore BB; Wong K; Grant D; Chalasani S; Carano RA; Frantz GD; Tessier-Lavigne M; Bolon B; French DM; Ashkenazi A. Secreted Sulfatases Sulf1 and Sulf2 Have Overlapping yet Essential Roles in Mouse Neonatal Survival. PLoS ONE 2007 2(6):e575, an open-access article distributed under the terms of the Creative Commons Attribution License

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
B is a lateral view. G is viewed from a rostral position, with dorsal at the top.
Expression Pattern Description
Spatial Annotation:
EMAGE:5117Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5117_wholemount_moderate.wlz
5117_wholemount_weak.wlz
5117_wholemount_possible.wlz
5117_wholemount_notDetected.wlz
5117_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5117_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
midbrain floor plate
detected detected
rhombomere 01 floor plate
detected detected
rhombomere 02 floor plate
detected detected
rhombomere 03 floor plate
detected detected
rhombomere 04 floor plate
detected detected
rhombomere 05 floor plate
detected detected
rhombomere 06 floor plate
detected detected
rhombomere 07 floor plate
detected detected
rhombomere 08 floor plate
detected detected
neural tube floor plate
detected detected
4th ventricle
detected detected
regionalExpressed in choroid plexus
brain
detected detected
regionalExpressed in choroid plexus
branchial arch
detected detected
regionalExpressed in clefts of branchial arches
telencephalon
detected detected
regionalExpressed dorsally
eye
detected detected
trunk somite
detected detected
olfactory pit
detected detected
forelimb bud
detected detected
Detected in arm girdle
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Sulf1 probeA
Entity Detected:Sulf1, sulfatase 1 ( MGI:2138563)
Sequence:sense strand is shown

>Sulf1 probeA
ACCAGTCAGCCAGAGCGTGGAAGGACCATAAGGCCTACATTGATAAAGAGATTGAAGTTCTACAAGATAA
AATTAAGAATTTAAGGGAAGTGAGGGGACACCTAAAGAAAAGGAAACCTGAGGAGTGTGGCTGTGGTGAC
CAGAGCTATTACAACAAAGAGAAAGGTGTCAAACGACAGGAGAAGCTAAAGAGTCACCTTCACCCCTTCA
AGGAGGCTGCTGCCCAGGAGGTGGATAGCAAACTTCAGCTCTTCAAGGAGCATCGGAGGAGGAAGAAGGA
GAGGAAGGAGAAGAAACGGCAGAGGAAGGGAGAGGAGTGTAGCCTGCCTGGCCTTACCTGCTTCACCCAT
GACAACAACCACTGGCAGACTGCCCCATTCTGGAACTTGGGATCTTTCTGTGCCTGCACAAGTTCTAACA
ACAATACCTACTGGTGTTTGCGTACAGTCAACGAGACGCACAATTTCCTGTTTTGTGAGTTTGCTACTGG
CTTTCTGGAATATTTCGACATGAATACGGATCCTTATCAGCTCACAAATACAGTACACACAGTAGAACGG
AGCATCTTAAATCAGCTACACATACAGCTGATGGAGCTCCGAAGCTGCCAAGGGTATAAACAGTGCAACC
CAAGACCCAAGAGCCTGGACATTGGAGCTAAAGAAGGAGGAAACTATGACCCGCACAGAGGACAGTTATG
GGATGGATGGGAAG
nt 2361 - nt 3074 of NM_172294.1
Notes:The Sulf1 probe used in this study by Holst et al., 2007 [PMID:17593974] is described as follows: "Primers used to amplify the Sulf1 transcript from a mouse embryo cDNA library to TOPO-clone into pCR-II-TOPO (Invitrogen, Carlsbad, CA) were Sulf1-wmISH-S, ACC AGT CAG CCA GAG CGT and Sulf1-wmISH-AS, CTT CCC ATC CAT CCC ATA ACT. Following sequencing to ensure fidelity of the amplification and orientation of insertion, we generated antisense, DIG-labeled probe from linearized plasmid template".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Holst CR; Bou-Reslan H; Gore BB; Wong K; Grant D; Chalasani S; Carano RA; Frantz GD; Tessier-Lavigne M; Bolon B; French DM; Ashkenazi A. 2007 [PMID:17593974] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1371/journal.pone.0000575] [ PMID:17593974] Holst CR, Bou-Reslan H, Gore BB, Wong K, Grant D, Chalasani S, Carano RA, Frantz GD, Tessier-Lavigne M, Bolon B, French DM, Ashkenazi A 2007 Secreted sulfatases Sulf1 and Sulf2 have overlapping yet essential roles in mouse neonatal survival. PLoS ONE (2):e575
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE