Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5119

Suv39h1 suppressor of variegation 3-9 homolog 1 (Drosophila) ( MGI:1099440)
TS14 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5119
Fig4B-Suv39h1-E9.5 of Mol Cell Biol 2000 20(24):9423-33 [PMID:11094092] O'Carroll D; Scherthan H; Peters AH; Opravil S; Haynes AR; Laible G; Rea S; Schmid M; Lebersorger A; Jerratsch M; Sattler L; Mattei MG; Denny P; Brown SD; Schweizer D; Jenuwein T, " Isolation and characterization of suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5119Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5119_wholemount_moderate.wlz
5119_wholemount_weak.wlz
5119_wholemount_notDetected.wlz
5119_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5119_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
The Suv39h1 antisense probe detects a broad distribution of transcripts suggesting ubiquitous expression.
extraembryonic component
detected detected
Detected in the allantois
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Suv39h1 probeA
Entity Detected:Suv39h1, suppressor of variegation 3-9 homolog 1 (Drosophila) ( MGI:1099440)
Sequence:sense strand is shown

>Suv39h1 probeA
CTAGCCAATTACCTGGTGCAGAAGGCCAAGCAGAGGCGGGCACTTCAGCGTTGGGAACAAGAGCTCAATG
CCAAGCGCAGCCACCTGGGGCGGATCACCGTGGAGAATGAGGTAGACCTGGATGGCCCTCCAAGGTCCTT
TGTCTATATCAATGAGTATCGAGTTGGTGAGGGCATCACCCTCAACCAGGTAGCTGTTGGCTGTGAGTGC
CAGGACTGTCTGTTGGCACCCACTGGAGGCTGTTGCCCTGGAGCATCCCTGCACAAGTTTGCCTACAATG
ACCAAGGCCAGGTGCGACTGAAAGCTGGGCAGCCCATCTACGAGTGCAACTCCCGCTGTTGCTGTGGCTA
TGACTGCCCAAACCGTGTAGTCC
nt 364 - nt 736 of NM_011514.1
Notes:The Suv39h1 probe used in this study by O'Carroll et al., 2000 [PMID:11094092] is described as "an internal 395-bp DNA fragment encoding amino acids 113 to 237 of Suv39h1 (Aagaard et al, 1999 [PMID:10202156] )". Aagaard et al describe the probe template as "a 395 bp PCR-amplified SalI-BamHI fragment (encoding amino acids 113-237 of Suv39h1) that had been subcloned into pGEM-3Zf". Editors note: The 395bp region presumably contains the PCR primer/linker sequences as amplifying a region covering 124 amino acids would result in a fragment of 372bp in length, and there are no SalI or BamHI sites in the mouse Suv39h1 cDNA RefSeq NM_011514.1.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:O'Carroll D; Scherthan H; Peters AH; Opravil S; Haynes AR; Laible G; Rea S; Schmid M; Lebersorger A; Jerratsch M; Sattler L; Mattei MG; Denny P; Brown SD; Schweizer D; Jenuwein T. 2000 [PMID:11094092] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1128/MCB.20.24.9423-9433.2000] [ PMID:11094092] O'Carroll D, Scherthan H, Peters AH, Opravil S, Haynes AR, Laible G, Rea S, Schmid M, Lebersorger A, Jerratsch M, Sattler L, Mattei MG, Denny P, Brown SD, Schweizer D, Jenuwein T 2000 Isolation and characterization of Suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression. Mol Cell Biol (20):9423-33
 [ doi:10.1093/emboj/18.7.1923] [ PMID:10202156] Aagaard L, Laible G, Selenko P, Schmid M, Dorn R, Schotta G, Kuhfittig S, Wolf A, Lebersorger A, Singh PB, Reuter G, Jenuwein T 1999 Functional mammalian homologues of the Drosophila PEV-modifier Su(var)3-9 encode centromere-associated proteins which complex with the heterochromatin component M31. EMBO J (18):1923-38
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE