Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5120

Suv39h2 suppressor of variegation 3-9 homolog 2 (Drosophila) ( MGI:1890396)
TS14 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5120 EMAGE:5120
Fig4B-Suv39h2-E9.5 of Mol Cell Biol 2000 20(24):9423-33 [PMID:11094092] O'Carroll D; Scherthan H; Peters AH; Opravil S; Haynes AR; Laible G; Rea S; Schmid M; Lebersorger A; Jerratsch M; Sattler L; Mattei MG; Denny P; Brown SD; Schweizer D; Jenuwein T, " Isolation and characterization of suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000. Fig4B-sense-E9.5 of Mol Cell Biol 2000 20(24):9423-33 [PMID:11094092] O'Carroll D; Scherthan H; Peters AH; Opravil S; Haynes AR; Laible G; Rea S; Schmid M; Lebersorger A; Jerratsch M; Sattler L; Mattei MG; Denny P; Brown SD; Schweizer D; Jenuwein T, " Isolation and characterization of suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2000.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
The specimen shown on the left was hybridised with anti-sense probe and the specimen on the right with sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:5120Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5120_wholemount_moderate.wlz
5120_wholemount_possible.wlz
5120_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5120_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
"The Suv39h2 antisense probe reveals a rather uniform expression throughout the entire fetus"
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Suv39h2 probeA
Entity Detected:Suv39h2, suppressor of variegation 3-9 homolog 2 (Drosophila) ( MGI:1890396)
Sequence:sense strand is shown

>Suv39h2 probeA
CAACCTGCAATTGCTGAGTATATTGTACAGAAAGCTAAGCAAAGAATAGCTCTGCAGAGATGGCAAGATT
ACCTCAACAGAAGAAAGAACCATAAGGGGATGATATTTGTTGAAAACACTGTTGACTTGGAGGGCCCACC
TTTAGACTTCTACTACATTAACGAGTACAGGCCAGCTCCCGGGATCAGCATAAACAGTGAAGCCACCTTT
GGATGTTCATGTACAGACTGCTTCTTTGACAAGTGTTGTCCTGCTGAAGCTGGAGTTGTGTTGGCTTATA
ATAAGAAGCAACAAATTAAAATCCAACCAGGCA
nt 576 - nt 888 of NM_022724.3
Notes:The Suv39h2 probe used in this study by O'Carroll et al., 2000 [PMID:11094092] is described as a PCR amplified "325-bp internal DNA fragment encoding amino acids 186 to 290 of Suv39h2". "In situ RNA probes were internally labeled with DIG-UTP (Boehringer Mannheim) by transcription with SP6 (antisense probes of EcoRI-linearized plasmid) or T7 RNA polymerase (sense probes of BamHI-linearized plasmid)". Editors note: The 325bp amplified region presumably contains the PCR primer/linker sequences as amplifying a region covering 104 amino acids would result in a fragment of 312bp in length.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:O'Carroll D; Scherthan H; Peters AH; Opravil S; Haynes AR; Laible G; Rea S; Schmid M; Lebersorger A; Jerratsch M; Sattler L; Mattei MG; Denny P; Brown SD; Schweizer D; Jenuwein T. 2000 [PMID:11094092] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1128/MCB.20.24.9423-9433.2000] [ PMID:11094092] O'Carroll D, Scherthan H, Peters AH, Opravil S, Haynes AR, Laible G, Rea S, Schmid M, Lebersorger A, Jerratsch M, Sattler L, Mattei MG, Denny P, Brown SD, Schweizer D, Jenuwein T 2000 Isolation and characterization of Suv39h2, a second histone H3 methyltransferase gene that displays testis-specific expression. Mol Cell Biol (20):9423-33
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE