Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5127

Arnt aryl hydrocarbon receptor nuclear translocator ( MGI:88071)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5127 EMAGE:5127
Fig4C of Mol Cell Biol 1996 16(4): 1706-1713 [PMID:8657146] Hirose K; Morita M; Ema M; Mimura J; Hamada H; Fujii H; Saijo Y; Gotoh O; Sogawa K; Fujii-Kuriyama Y, "cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt)." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 1996. Fig4D of Mol Cell Biol 1996 16(4): 1706-1713 [PMID:8657146] Hirose K; Morita M; Ema M; Mimura J; Hamada H; Fujii H; Saijo Y; Gotoh O; Sogawa K; Fujii-Kuriyama Y, "cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt)." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 1996.

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Fig 4C shows an embryo hybridised with anti-sense probe and Fig4D shows a control embryo hybridised with sense probe.
Expression Pattern Description
Spatial Annotation:
EMAGE:5127Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5127_wholemount_possible.wlz
5127_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5127_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
regionalArnt mRNA was expressed broadly in various tissues of mesodermal and endodermal origins.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Arnt probeA
Entity Detected:Arnt, aryl hydrocarbon receptor nuclear translocator ( MGI:88071)
Sequence:sense strand is shown

>Arnt probeA
TTGTAGAATTTTGTCATCCTGAAGACCAACAACTTCTAAGAGACAGCTTTCAGCAGGTGGTGAAATTAAA
AGGTCAGGTGCTGTCCGTCATGTTCCGATTCCGATCTAAGACCCGAGAATGGCTGTGGATGAGAACGAGC
TCCTTTACCTTCCAAAACCCTTATTCAGATGAAATTGAGTATATTATCTGCACCAACACCAATGTGAAGA
ACTCTAGCCAGGAACCACGGCCTACACTGTCCAACACCATCCCAAGGTCACAGCTAGGTCCGACAGCCAA
TTTATCCCTAGAGATGGGTACAGGGCAGCTGCCATCCAGGCAGCAGCAGCAGCAGCACACAGAACTGGAT
ATGGTACCAGGAAGAGATGGGCTGGCCAGCTATAATCATTCCCAGGTTTCTGTCCAGCCTGTGGCAAGTG
CAGGATCAGAACACAGCAAGCCCCTTGAGAAGTCAGAAGGTCTCTTTGCACAGGACAGAGATCCAAGGTT
TCCAGAAATCTATCCCAGCATCACTGCAGATCAGAGTAAAGGCATCTCCTCCAGCACTGTCCCTGCCACC
CAACAGCTGTTCTCCCAGGGCAGCTCATTCCCTCCTAACCCCCGGCCGGCAGAGAATTTCAGGAATAGTG
GTCT
nt 1289 - nt 1922 of NM_009709.4
Notes:The Arnt probe template used in this study by Hirose et al., 1996 [PMID:8657146] is described as follows: "For Arnt, a fragment of the 3' coding sequence (0.62 kb) of Arnt cDNA was amplified by using a pair of primers, 5'-TTGTAGAATTTTGTCATCCT-3' and 5'-AGACCACTATTCCTGAAATT-3', and inserted into pBluescriptSK(1) (Stratagene)".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Hirose K; Morita M; Ema M; Mimura J; Hamada H; Fujii H; Saijo Y; Gotoh O; Sogawa K; Fujii-Kuriyama Y, 1996 [PMID:8657146] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8657146] Hirose K, Morita M, Ema M, Mimura J, Hamada H, Fujii H, Saijo Y, Gotoh O, Sogawa K, Fujii-Kuriyama Y 1996 cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt). Mol Cell Biol (16):1706-13
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE