Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5128

Arnt2 aryl hydrocarbon receptor nuclear translocator 2 ( MGI:107188)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5128 EMAGE:5128
Fig4A of Mol Cell Biol 1996 16(4): 1706-1713 [PMID:8657146] Hirose K; Morita M; Ema M; Mimura J; Hamada H; Fujii H; Saijo Y; Gotoh O; Sogawa K; Fujii-Kuriyama Y, "cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt)." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 1996. Fig4B of Mol Cell Biol 1996 16(4): 1706-1713 [PMID:8657146] Hirose K; Morita M; Ema M; Mimura J; Hamada H; Fujii H; Saijo Y; Gotoh O; Sogawa K; Fujii-Kuriyama Y, "cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt)." © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 1996.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5128Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5128_wholemount_moderate.wlz
5128_wholemount_possible.wlz
5128_wholemount_notDetected.wlz
5128_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5128_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
1st branchial arch
detected detected
Expression of Arnt2 mRNA was restricted to the dorsal spinal cord and branchial arch 1.
future spinal cord
detected detected
regionalExpression of Arnt2 mRNA was restricted to the dorsal spinal cord and branchial arch 1.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Arnt2 probeA
Entity Detected:Arnt2, aryl hydrocarbon receptor nuclear translocator 2 ( MGI:107188)
Sequence:sense strand is shown

>Arnt2 probeA
GTCCCAGTACCCAACCTACCCGCTGGTGTTCACGAGGCCGGGAAGTCTGTGGAAAAGGCAGATGCAATCT
TCTCCCAAGAGAGAGACCCTCGTTTTGCTGAGATGTTTGCAGGCATCAGTGCATCTGAGAAGAAGATGAT
GAGCTCAGCCTCAGCATCAGGCAGCCAGCAGATCTACTCCCAAGGAAGTCCATTCCCTGCCGGGCACTCG
GGCAAGGCCTTCAGCTCTTCCGTGGTCCATGTGCCTGGAGTGAATGACATTCAGTCCTCCTCCTCAACGG
GACAGAACATATCCCAGATCTCTCGGCAGCTGAACCAGGGCCAGGTGGCATGGACAGGCAGCCGTCCACC
GTTCCCAGGGCAGCCCAGCAAGACGCAGTCATCTGCCTTCGGAATTGGATCAAGCCACCCTTACCCGGCT
GACCCTTCATCCTACAGTCCTCTCTCCAGCCCAGCTGCCTCCTCACCAAGTGGAAACGCATACCCCAGTC
TTGCCAACAGGACTCCAGGGTTTGCTGAGAGTGGACAGAGTGGCGGGCAGTTCCAGGGCCGGCCCTCGGA
GGTCTGGTCCCAGTGGCAGAGCCAGCATCACGGACAGCAGAGCGGTGAGCAGCACTCGCATCAGCAGCCT
GGCCAGACTGAAGTGTTCCAGGACATGCTACCCATGCCGGGCGACCCGACGCAGGGGACTGGCAACTATA
ACATCGAGGACTTTGCTGACCTGGGCATGTTCCCTCCATTTTCTGAGTAGCTTCAGGCAAAGCCAGGCTT
CTACTGCCCAGACGCTATTATCATGCCATAGATGCCCATGTTCAAAGAGG
nt 1419 - nt 2238 of D63644.1
Notes:The Arnt2 probe template used in this study by Hirose et al., 1996 [PMID:8657146] is described as follows: "For the Arnt2 probe, an EcoO109I fragment (0.82 kb) of Arnt2 cDNA was excised and inserted into pBluescriptSK(1)."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Hirose K; Morita M; Ema M; Mimura J; Hamada H; Fujii H; Saijo Y; Gotoh O; Sogawa K; Fujii-Kuriyama Y, 1996 [PMID:8657146] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8657146] Hirose K, Morita M, Ema M, Mimura J, Hamada H, Fujii H, Saijo Y, Gotoh O, Sogawa K, Fujii-Kuriyama Y 1996 cDNA cloning and tissue-specific expression of a novel basic helix-loop-helix/PAS factor (Arnt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear translocator (Arnt). Mol Cell Biol (16):1706-13
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE