Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5147

Asb4 ankyrin repeat and SOCS box-containing 4 ( MGI:1929751)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5147 EMAGE:5147 EMAGE:5147
Fig4A of [doi:10.1128/MCB.00511-07] 2007 Mol Cell Biol 27(18): 6407-6419, Ferguson JE 3rd; Wu Y; Smith K; Charles P; Powers K; Wang H; Patterson C, ASB4 is a hydroxylation substrate of FIH and promotes vascular differentiation via an oxygen-dependent mechanism" © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2007. [PMID:17636018] Fig4B of [doi:10.1128/MCB.00511-07] 2007 Mol Cell Biol 27(18): 6407-6419, Ferguson JE 3rd; Wu Y; Smith K; Charles P; Powers K; Wang H; Patterson C, ASB4 is a hydroxylation substrate of FIH and promotes vascular differentiation via an oxygen-dependent mechanism" © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2007. [PMID:17636018] Fig4C of [doi:10.1128/MCB.00511-07] 2007 Mol Cell Biol 27(18): 6407-6419, Ferguson JE 3rd; Wu Y; Smith K; Charles P; Powers K; Wang H; Patterson C, ASB4 is a hydroxylation substrate of FIH and promotes vascular differentiation via an oxygen-dependent mechanism" © ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2007. [PMID:17636018]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
(A) E9.5 embryo. Arrow, allantois; arrowhead, forelimb; bar, 500 �m. (B) E9.5 embryo at high magnification. Arrow, rostral capillary plexus; arrowheads, branchial arch capillary plexi; bar, 50 �m. (C) E9.5 embryo probed with sense probe as a negative control. Bar, 500 �m.
Expression Pattern Description
Spatial Annotation:
EMAGE:5147Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5147_wholemount_moderate.wlz
5147_wholemount_strong.wlz
5147_wholemount_weak.wlz
5147_wholemount_notDetected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5147_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
extraembryonic vascular system
detected detected
regionalASB4 is expressed in the allantois/umbilical vessels, and yolk sac vasculature.
dorsal aorta
detected detected
forelimb bud
detected detected
vitelline artery
detected detected
vitelline vein embryonic part
detected detected
septum transversum
detected detected
embryo
detected detected
regionalASB4 is expressed in the intersomitic vessels, proepicardium, capillary plexi of the head and branchial arches, and endocardium.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Asb4 probeA
Entity Detected:Asb4, ankyrin repeat and SOCS box-containing 4 ( MGI:1929751)
Sequence:sense strand is shown

>Asb4 probeA
TGGACGGCATCACTGCCCCTATCAGCAAAGCTGGAGCTGCCAAATTAGTTAAGAAAGATTTCCTGGAGGC
TCTAAAAACAAATGACTTCGGAAAACTGAAGGCTATTTTAATCGAGAGGCAAATAGATGTGGACACAGTG
TTTGAAGTTGAAGATGAGAACATGATTTTGGCATCTTACAAACAAGGCTATTGGTTGCCCAGTTATAAGC
TGAAGTCTTCCTGGGCCACAGGCCTGCATCTGTCAGTTTTGCTTGGTCATGTGGAGTGCCTGATGGTACT
GCTGGACCACAATGCTACCATCAACTGTCGTCCCAACGGGAAGACCCCTCTGCACGTGGCTTGTGAAATC
GCCAACCTCGAGTGCGTGAAGATTCTCTGTGACCGTGGCGCAAAGCTCAACTGCTACTCCCTGAGTGGGC
ACACTGCTTTGCACTTCTGCACCACACCGAGCTCCATCCTCTGTGCCAAGCAGTTGGTGTTGAGAGGTGC
AAACGTAAACATGAAAACCAACAACCAGGATGAAGAGACACCCCTGCACACGGCGGCCCACTTCGGCCTC
TCTGAGCTGGTTGCCTTCTACGTGGAGAACGGGGCCATCGTGGATAGCATGAACGCCCACATGGAGACCC
CACTGGCCATTGCCACCTACTGGGCCCTGCGCTTCAAGGAGCAGGAGTACAGCAGGGAACACCACCTCAT
CTGCCGCACCCTGCTGGACAACAACGCCGAGGTCAACGCTCGTGATGATGATTTCAAGTCCCCTCTACAC
AAGGCTGCCTGGAATTGCGACCACGTGCTCATGCACATGATGCTGGAGGCAGGAGCTGAGGCCAACCTCA
TGGATATCAATGGCTGTGCCGCTATCCAGTACGTGCTGAAGGTCACCTCCGTGCGTCCTGCTGCACAGCC
TGAG
nt 32 - nt 945 of NM_023048.5
Notes:The Asb4 probe used in this study by Ferguson et al., 2007 [PMID:17636018] is described as follows: "A 900-bp template for ASB4 probe preparation was prepared with forward primer 5'TATCCATGGTGGACGGCATCACTGCCCCTATC and reverse primer 5'CTCAGGCTGTGCAGCAGGACGC) and TA cloned into the pCRIItopo vector (Invitrogen)."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Ferguson JE 3rd; Wu Y; Smith K; Charles P; Powers K; Wang H; Patterson C, 2007 [PMID:17636018] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1128/MCB.00511-07] [ PMID:17636018] Ferguson JE, Wu Y, Smith K, Charles P, Powers K, Wang H, Patterson C 2007 ASB4 is a hydroxylation substrate of FIH and promotes vascular differentiation via an oxygen-dependent mechanism. Mol Cell Biol (27):6407-19
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE