Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5157

Tfap2e transcription factor AP-2, epsilon ( MGI:2679630)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5157 EMAGE:5157 EMAGE:5157
Fig3A. Copyright: This image is from [doi:10.1002/dvdy.20119] Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M, "Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon." Dev Dyn 2004 Sep;231(1):128-35. Reprinted with permission of Wiley-Liss Inc. [PMID:15305293] . Fig3B. Copyright: This image is from [doi:10.1002/dvdy.20119] Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M, "Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon." Dev Dyn 2004 Sep;231(1):128-35. Reprinted with permission of Wiley-Liss Inc. [PMID:15305293] . Fig3C. Copyright: This image is from [doi:10.1002/dvdy.20119] Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M, "Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon." Dev Dyn 2004 Sep;231(1):128-35. Reprinted with permission of Wiley-Liss Inc. [PMID:15305293] .

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrows point to expression regions in midbrain, hindbrain and spinal cord. A - lateral view, B - frontal view, C - dorsal view.
Expression Pattern Description
Spatial Annotation:
EMAGE:5157Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5157_wholemount_moderate.wlz
5157_wholemount_weak.wlz
5157_wholemount_possible.wlz
5157_wholemount_notDetected.wlz
5157_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5157_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
midbrain
detected detected
regionalThere are two lateral regions of AP-2epsilon expression in the anterior midbrain (see arrows in Fig3B).
hindbrain
detected detected
regionalThere is staining anterior of the fourth ventricle
future spinal cord
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Tcfap2e probeA
Entity Detected:Tfap2e, transcription factor AP-2, epsilon ( MGI:2679630)
Sequence:sense strand is shown

>Tcfap2e probeA
GCCTCGGAGAAGGATACCAAGCATCGGAAGTAACTGGCTCTTGTTCCCTAGCTAAATGACTCCCAGAGCC
TGAGATGGGGCCTTGGCTCCTGGGGGTAAAATGTGGGATTCTATTCAGGCCAGAGAGAACATTTTTCCAG
AAGCCCAGAGTGGGACATAGTTGGGTAAAAGAAGAAGGCTTTTCTGTGGTTTCTGGTAAGGACTCGTAAC
GCGAACTGGCATGGGAAAGTCTGGCTCAGGGGACAGAGCCCTTCCCACTGAGATGCCTGGGCAGCCATGG
GTACCCCGAGGCTGATAACACATCAGAGGTGCTATTGAAGAATTAGTGACCTTCACTTCAGTCTCTTAGT
CTCAGAACCCAGAAGGAGGGTCCAGTGGGCTCTTTGGATCCTTCAGGCTCTTGGAGACGAGAAGCTGGAG
AGACCCCTGAAGAACGAGATGGTACAGCACAAACTACTGAACTTGAACCTAGGCTGCATTACCACAGTCC
TGTTGCTGCCTGTCTTATTTATTTATATACGATCTAA
nt 1575 - nt 2101 of NM_198960.2
Notes:The Tcfap2e (AP-2epsilon) probe used in this study by Wang et al., 2004 [PMID:15305293] was "a 526-bp fragment obtained from the 3'UTR region of the murine AP-2epsilon cDNA (that) was excised with StuI/SalI from the murine IMAGE clone (IMAGE 778986) and subcloned into pBluescript. Digoxigenin-labeled cRNA sense and antisense probes were in vitro transcribed from the linearized plasmid". Editors note: in GenBank, only 5' sequence is available for IMAGE:778986 (AA414551.1). In the derivation of the Knowles Solter mouse 2 cell cDNA library (which IMAGE:778986 is from), the polyT primer had a SalI site attached. There is only one StuI site in the Tcfap2e mouse cDNA RefSeq NM_198960.2 (at position 1575). A 526bp fragment extends from this site to position 2101 in NM_198960.2, which is presumed to correspond to the 3' end of the insert of IMAGE:778986.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M. 2004 [PMID:15305293] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.20119] [ PMID:15305293] Wang HV, Vaupel K, Buettner R, Bosserhoff AK, Moser M 2004 Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon. Dev Dyn (231):128-35
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE