Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5158

Tfap2e transcription factor AP-2, epsilon ( MGI:2679630)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:5158 EMAGE:5158
Fig3D. Copyright: This image is from [doi:10.1002/dvdy.20119] Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M, "Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon." Dev Dyn 2004 Sep;231(1):128-35. Reprinted with permission of Wiley-Liss Inc. [PMID:15305293] . Fig3E. Copyright: This image is from [doi:10.1002/dvdy.20119] Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M, "Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon." Dev Dyn 2004 Sep;231(1):128-35. Reprinted with permission of Wiley-Liss Inc. [PMID:15305293] .

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrows point to expression in the primordium of the olfactory bulb.
Expression Pattern Description
Spatial Annotation:
EMAGE:5158Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5158_wholemount_moderate.wlz
5158_wholemount_weak.wlz
5158_wholemount_possible.wlz
5158_wholemount_notDetected.wlz
5158_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5158_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
telencephalon
detected detected
regionalExpression is in the primordium of the olfactory bulbs. Sectioning confirmed the restricted AP-2epsilon expression in the neuroepithelium and did not reveal any signals in neural crest cells (data not shown).
head mesenchyme derived from neural crest
not detected not detected
homogeneousSectioning of these embryos confirmed the restricted AP-2epsilon expression in the neuroepithelium and did not reveal any signals in neural crest cells (data not shown).
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Tcfap2e probeA
Entity Detected:Tfap2e, transcription factor AP-2, epsilon ( MGI:2679630)
Sequence:sense strand is shown

>Tcfap2e probeA
GCCTCGGAGAAGGATACCAAGCATCGGAAGTAACTGGCTCTTGTTCCCTAGCTAAATGACTCCCAGAGCC
TGAGATGGGGCCTTGGCTCCTGGGGGTAAAATGTGGGATTCTATTCAGGCCAGAGAGAACATTTTTCCAG
AAGCCCAGAGTGGGACATAGTTGGGTAAAAGAAGAAGGCTTTTCTGTGGTTTCTGGTAAGGACTCGTAAC
GCGAACTGGCATGGGAAAGTCTGGCTCAGGGGACAGAGCCCTTCCCACTGAGATGCCTGGGCAGCCATGG
GTACCCCGAGGCTGATAACACATCAGAGGTGCTATTGAAGAATTAGTGACCTTCACTTCAGTCTCTTAGT
CTCAGAACCCAGAAGGAGGGTCCAGTGGGCTCTTTGGATCCTTCAGGCTCTTGGAGACGAGAAGCTGGAG
AGACCCCTGAAGAACGAGATGGTACAGCACAAACTACTGAACTTGAACCTAGGCTGCATTACCACAGTCC
TGTTGCTGCCTGTCTTATTTATTTATATACGATCTAA
nt 1575 - nt 2101 of NM_198960.2
Notes:The Tcfap2e (AP-2epsilon) probe used in this study by Wang et al., 2004 [PMID:15305293] was "a 526-bp fragment obtained from the 3'UTR region of the murine AP-2epsilon cDNA (that) was excised with StuI/SalI from the murine IMAGE clone (IMAGE 778986) and subcloned into pBluescript. Digoxigenin-labeled cRNA sense and antisense probes were in vitro transcribed from the linearized plasmid". Editors note: in GenBank, only 5' sequence is available for IMAGE:778986 (AA414551.1). In the derivation of the Knowles Solter mouse 2 cell cDNA library (which IMAGE:778986 is from), the polyT primer had a SalI site attached. There is only one StuI site in the Tcfap2e mouse cDNA RefSeq NM_198960.2 (at position 1575). A 526bp fragment extends from this site to position 2101 in NM_198960.2, which is presumed to correspond to the 3' end of the insert of IMAGE:778986.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Wang HV; Vaupel K; Buettner R; Bosserhoff AK; Moser M. 2004 [PMID:15305293] . Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.20119] [ PMID:15305293] Wang HV, Vaupel K, Buettner R, Bosserhoff AK, Moser M 2004 Identification and embryonic expression of a new AP-2 transcription factor, AP-2 epsilon. Dev Dyn (231):128-35
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE