Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5184

Traf6 TNF receptor-associated factor 6 ( MGI:108072)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5184
Fig 2B Lomaga MA; Henderson JT; Elia AJ; Robertson J; Noyce RS; Yeh WC; Mak TW "Tumor necrosis factor receptor-associated factor 6 (TRAF6) deficiency results in exencephaly and is required for apoptosis within the developing CNS" 2000 J Neurosci 20(19):7384-93. [PMID:11007897]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5184Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5184_wholemount_moderate.wlz
5184_wholemount_weak.wlz
5184_wholemount_notDetected.wlz
5184_wholemount_strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5184_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
future forebrain
strong strong
The highest levels of expression are in the forebrain.
future midbrain
moderate moderate
Expression levels are lower in the midbrain and hindbrain regions than they are in the forebrain.
future hindbrain
moderate moderate
Expression levels are lower in the midbrain and hindbrain regions than they are in the forebrain.
optic stalk
detected detected
otocyst
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3575653
Entity Detected:Traf6, TNF receptor-associated factor 6 ( MGI:108072)
Sequence:sense strand is shown

>MGI:3575653
CTGCATCTTCAGTTACCGACAGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAG
GAGAATATGACAGCCACCTCCCCTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTCGACCAGTCTGA
AGCACTTATAAGGCAAAACCACGAAGAGGTCATGGACGCCAAACCAGAACTGCTTGCCTTTC
nt 1607 - nt 1808 of NM_009424.2
Notes:The Traf6 probes used in this study by Lomaga et al., 2000 [PMID:11007897] is described as follows "antisense and sense (control) probes for traf6 were derived from an ~200 bp murine cDNA encoding amino acids 400-467".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:involves: CD-1 * ICR
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Lomaga MA; Henderson JT; Elia AJ; Robertson J; Noyce RS; Yeh WC; Mak TW. 2000 [PMID:11007897] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11007897] Lomaga MA, Henderson JT, Elia AJ, Robertson J, Noyce RS, Yeh WC, Mak TW 2000 Tumor necrosis factor receptor-associated factor 6 (TRAF6) deficiency results in exencephaly and is required for apoptosis within the developing CNS. J Neurosci (20):7384-93
Links:MGI:3575658 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI