Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5215

Wnt10b wingless related MMTV integration site 10b ( MGI:108061)
TS18 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:5215
Fig7A Copyright: Reprinted with permission from Elsevier from [doi:10.1016/0925-4773(95)00383-5] Mech Dev 51: 341-501, Christiansen JH; Dennis CL; Wicking CA; Monkley SJ; Wilkinson DG; Wainwright BJ, Murine Wnt-11 and Wnt-12 have temporally and spatially restricted expression patterns during embryonic development. Copyright 1995. [PMID:7547479]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
(A) 11.5 dpc embryo showing expression of Wnt10b in the apical ectodermal ridge of both the fore and hind limbs (closed arrows) as well as in the mammary ridge (open arrow).
Expression Pattern Description
Spatial Annotation:
EMAGE:5215Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5215_wholemount__notDetected.wlz
5215_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5215_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
surface ectoderm
detected detected
regionalExpression in the mammary ridge.
forelimb bud apical ectodermal ridge
detected detected
hindlimb bud apical ectodermal ridge
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Wnt10b probeB
Entity Detected:Wnt10b, wingless related MMTV integration site 10b ( MGI:108061)
Sequence:sense strand is shown

>Wnt10b probeB
CAGGAATGTAAGTGTCATGGAACGTCAGGCAGCTGCCAATTCAAGACCTGTTGGAGGGCAGCGCCAGAGT
TCCGGGCCATCGGGGCAGCACTGAGGGAGCGGCTGAGCAGAGCCATCTTTATCGATACCCACAACCGTAA
CTCTGGGGCGTTCCAGCCGCCTACGTCCGCCGGCGCCTCTCTGGAGAGCCTGGTTTACTTTGAGAAGTCT
CCTGACTTCTGCGAGCGAGACCCTACTCTGGGCTCCCCAGGCACGAGAGGCCGGGCTTGCAACAAGACCA
GCCGCCTCTTGGATGGCTGTGGCAGCCTGTGCTGTGGCCGTGGGCACAACGTGCTCCGGCAGACGCGAGT
GGAGCGCTGCCACTGTCGTTTCCATTGGTGCTGC
nt 1 - nt 384 of L33719.1
Notes:The Wnt10b (Wnt-12) probe used in this study by Christiansen et al., 1995 [PMID:7547479] was transcribed from "pBSM10 (Adamson et al, 1994 [PMID:7896292] )". Editors Note: Adamson et al, 1994 denote the full insert sequence of pBSM10 as L33719.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:Swiss
Age:11.5 dpc
Theiler Stage:TS18
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Christiansen JH; Dennis CL; Wicking CA; Monkley SJ; Wilkinson DG; Wainwright BJ. 1995 [PMID:7547479] Indexed and spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/0925-4773(95)00383-5] [ PMID:7547479] Christiansen JH, Dennis CL, Wicking CA, Monkley SJ, Wilkinson DG, Wainwright BJ 1995 Murine Wnt-11 and Wnt-12 have temporally and spatially restricted expression patterns during embryonic development. Mech Dev (51):341-50
 [ doi:10.1006/geno.1994.1575] [ PMID:7896292] Adamson MC, Dennis C, Delaney S, Christiansen J, Monkley S, Kozak CA, Wainwright B 1994 Isolation and genetic mapping of two novel members of the murine Wnt gene family, Wnt11 and Wnt12, and the mapping of Wnt5a and Wnt7a. Genomics (24):9-13
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE