Type: | in situ hybridisation probe |
Identifier: | Wnt3 probeB |
Entity Detected: | Wnt3, wingless-related MMTV integration site 3 ( MGI:98955) |
Sequence: | sense strand is shown
>Wnt3 probeB
AAGTGTAAATGCCACGGGTTGTCCGGCAGCTGCGAGGTGAAGACCTGCTGGTGGGCCCAGCCCGACTTCC
GTGCCATTGGCGACTTCCTCAAGGACAAGTACGACAGTGCCTCCGAGATGGTGGTGGAGAAACACCGTGA
GTCCCGAGGCTGGGTGGAGACCCTGCGGGCTAAGTACGCGCTCTTCAAGCCACCCACCGAGAGGGACCTG
GTCTACTACGAGAACTCCCCCAACTTTTGTGAGCCCAACCCAGAGACGGGCTCCTTTGGTACCAGGGACC
GGACTTGCAATGTCACCTCCCACGGCATCGATGGCTGCGATCTGCTGTGCTGTGGCCGGGGCCACAACAC
GAGGACGGAGAAACGGAAGGAGAAATGCCATTGCGTCTTCCACTGGTGCTGCT
|
| nt 658 - nt 1060 of NM_009521.1 |
Notes: | The Wnt3 probe used in this study by Parr et al., 1993 [PMID:8275860] is described as a "380 bp PCR product (coding)" Gavin et al, 1990 [PMID:2279700] .
Editors Note: the cloning strategy used by Gavin et al, 1990 is shown in Fig1 therein. The following two degenerate primers were used to amplify several Wnt cDNAs: forward 5'-GGGAATTCCARGARTGYAARTGYCAT-3' (corresponds to the WNT protein consensus amino acid sequence QECKCH) and reverse 5'-AAAATCTAGARCARCACCARTGRAA-3' (corresponds to the WNT protein consensus amino acid sequence FHWCC). The binding positions of these primers relative to the mouse Wnt3 cDNA RefSeq NM_009521.1 were deduced using this information. |
Chemistry: | RNA |
Strand: | antisense |
Label: | digoxigenin |