Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5217

Wnt3 wingless-related MMTV integration site 3 ( MGI:98955)
TS15 (29 Somite no.)
in situ hybridisation

Data Images
EMAGE:5217 EMAGE:5217
Fig2E. Copyright: This image is from Parr BA; Shea MJ; Vassileva G; McMahon AP, Development 1993;119(1):247-61 and is displayed with the permission of The Company of Biologist Limited who owns the Copyright. [PMID:8275860] Fig2F. Copyright: This image is from Parr BA; Shea MJ; Vassileva G; McMahon AP, Development 1993;119(1):247-61 and is displayed with the permission of The Company of Biologist Limited who owns the Copyright. [PMID:8275860]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
(E) At 9.5 days (29 somites), weak Wnt-3 expression is seen along dorsal regions of the CNS (arrows) and laterally in the diencephalon (arrowhead). (F) Frontal view showing the diencephalic patch of Wnt-3 staining (arrowhead). Wnt-3 expression is also evident at the dorsal midline up to the midbrain-diencephalon border (arrow).
Expression Pattern Description
Spatial Annotation:
EMAGE:5217Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5217_wholemount__moderate.wlz
5217_wholemount__possible.wlz
5217_wholemount__notDetected.wlz
5217_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5217_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
weak weak
regionalWeak Wnt-3 expression is seen along dorsal regions of the CNS, up to the midbrain-diencephalon border.
diencephalon lateral wall
detected detected
regionalThis lateral extension of Wnt-3 expression is anterior to a triangular patch of Wnt-3a expression. It does not extend to the dorsal midline.
diencephalon roof plate
not detected not detected
homogeneousThe lateral extension of Wnt-3 expression does not extend to the dorsal midline.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Wnt3 probeB
Entity Detected:Wnt3, wingless-related MMTV integration site 3 ( MGI:98955)
Sequence:sense strand is shown

>Wnt3 probeB
AAGTGTAAATGCCACGGGTTGTCCGGCAGCTGCGAGGTGAAGACCTGCTGGTGGGCCCAGCCCGACTTCC
GTGCCATTGGCGACTTCCTCAAGGACAAGTACGACAGTGCCTCCGAGATGGTGGTGGAGAAACACCGTGA
GTCCCGAGGCTGGGTGGAGACCCTGCGGGCTAAGTACGCGCTCTTCAAGCCACCCACCGAGAGGGACCTG
GTCTACTACGAGAACTCCCCCAACTTTTGTGAGCCCAACCCAGAGACGGGCTCCTTTGGTACCAGGGACC
GGACTTGCAATGTCACCTCCCACGGCATCGATGGCTGCGATCTGCTGTGCTGTGGCCGGGGCCACAACAC
GAGGACGGAGAAACGGAAGGAGAAATGCCATTGCGTCTTCCACTGGTGCTGCT
nt 658 - nt 1060 of NM_009521.1
Notes:The Wnt3 probe used in this study by Parr et al., 1993 [PMID:8275860] is described as a "380 bp PCR product (coding)" Gavin et al, 1990 [PMID:2279700] . Editors Note: the cloning strategy used by Gavin et al, 1990 is shown in Fig1 therein. The following two degenerate primers were used to amplify several Wnt cDNAs: forward 5'-GGGAATTCCARGARTGYAARTGYCAT-3' (corresponds to the WNT protein consensus amino acid sequence QECKCH) and reverse 5'-AAAATCTAGARCARCACCARTGRAA-3' (corresponds to the WNT protein consensus amino acid sequence FHWCC). The binding positions of these primers relative to the mouse Wnt3 cDNA RefSeq NM_009521.1 were deduced using this information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:29 Somite no.
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Parr BA; Shea MJ; Vassileva G; McMahon AP. 1993 [PMID:8275860] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:8275860] Parr BA, Shea MJ, Vassileva G, McMahon AP 1993 Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development (119):247-61
 [ doi:10.1101/gad.4.12b.2319] [ PMID:2279700] Gavin BJ, McMahon JA, McMahon AP 1990 Expression of multiple novel Wnt-1/int-1-related genes during fetal and adult mouse development. Genes Dev (4):2319-32
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE