Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5240

Egfl7 EGF-like domain 7 ( MGI:2449923)
TS15 (9 dpc)
in situ hybridisation

Data Images
EMAGE:5240 EMAGE:5240
Fig1A [doi:10.1038/nature02416] Nature 2004 428(6984): 754-8, Parker LH; Schmidt M; Jin SW; Gray AM; Beis D; Pham T; Frantz G; Palmieri S; Hillan K; Stainier DY; De Sauvage FJ; Ye W, The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. 2004 [PMID:15085134] © Nature Publishing Group. Reproduced with permission from Nature. Fig1B [doi:10.1038/nature02416] Nature 2004 428(6984): 754-8, Parker LH; Schmidt M; Jin SW; Gray AM; Beis D; Pham T; Frantz G; Palmieri S; Hillan K; Stainier DY; De Sauvage FJ; Ye W, The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. 2004 [PMID:15085134] © Nature Publishing Group. Reproduced with permission from Nature.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Egfl7 wholemount in situ hybridization. (a) E9 whole embryo. (b) Cross-section of a stained with nuclear fast red. RBC - red blood cells; EC - endothelial cells.
Expression Pattern Description
Spatial Annotation:
EMAGE:5240Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5240_wholemount__moderate.wlz
5240_wholemount__weak.wlz
5240_wholemount__notDetected.wlz
5240_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5240_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
arterial system
strong strong
regionalHigh levels of Egfl7 transcripts are detected in endothelial progenitors and endothelial cells in all vessels.
venous system
strong strong
regionalHigh levels of Egfl7 transcripts are detected in endothelial progenitors and endothelial cells in all vessels.
heart
detected detected
regionalExpression is detected in the endocardium.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Egfl7 probeA
Entity Detected:Egfl7, EGF-like domain 7 ( MGI:2449923)
Sequence:sense strand is shown

>Egfl7 probeA
CCATCTCGGAGACCTTTGTGCAGCGTGTATACCAGCCTTACCTCACCACTTGCGACGGACACAGAGCCTG
CAGCACCTACCGAACCATCTACCGGACTGCCTATCGCCGTAGCCCTGGGGTGACTCCCGCAAGCCTCGCT
ATGCTTGCTGCCCTGGTTGGAAGAGGACCAGTGGGCTCCCTGGGGCTTGTGGAGCAGCAATATGCCAGCC
TCCATGTGGGAATGGAGGGAGTTGCATCCGCCCAGGACACTGCCGCTGCCCTGTGGGATGGCAGGGAGAT
ACTTGCCAGACAGATGTTGATGAATGCAGTACAGGAGAGGCCAGTTGTCCCCAGCGCTGTGTCAATACTG
TGGGAAGTTACTGGTGCCAGGGATGGGAGGGACAAAGCCCATCTGCAGATGGGACGCGCTGCCTGTCTAA
GGAGGGGCCCTCCCGGTGGCCCCAACCCCACAGCAGGAGTGGACAGCA
Notes:The Egfl7 probe used in this study by Parker et al., 2004 [PMID:15085134] is described as follows: "Sense and antisense riboprobes were made using the following templates: a murine Egfl7 partial cDNA clone (IMAGE clone 519249, Genbank accession: AA107358)."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:CD-1
Age:9 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Parker LH; Schmidt M; Jin SW; Gray AM; Beis D; Pham T; Frantz G; Palmieri S; Hillan K; Stainier DY; De Sauvage FJ; Ye W, 2004 [PMID:15085134] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1038/nature02416] [ PMID:15085134] Parker LH, Schmidt M, Jin SW, Gray AM, Beis D, Pham T, Frantz G, Palmieri S, Hillan K, Stainier DY, De Sauvage FJ, Ye W 2004 The endothelial-cell-derived secreted factor Egfl7 regulates vascular tube formation. Nature (428):754-8
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE