Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5260

Epas1 endothelial PAS domain protein 1 ( MGI:109169)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5260 EMAGE:5260
Fig 7B. Copyright: This image is from Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, Proc Natl Acad Sci U S A 1997 Apr 29;94(9):4273-8. [PMID:9113979] Copyright 1997 National Academy of Sciences, U.S.A. Fig 7F. Copyright: This image is from Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, Proc Natl Acad Sci U S A 1997 Apr 29;94(9):4273-8. [PMID:9113979] Copyright 1997 National Academy of Sciences, U.S.A.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Lateral view of 9.5dpc embryo hybridized with HLF cRNA probe. Hybridization signal was observed clearly in the vascular system. Image annotations: *, nonspecific signal in the otic vesicle. F in Fig7B indicates position of section shown in Fig7F.
Expression Pattern Description
Spatial Annotation:
EMAGE:5260Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5260_wholemount__moderate.wlz
5260_wholemount__notDetected.wlz
5260_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5260_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
cardiovascular system
strong strong
regionalHLF mRNA was expressed abundantly in the vascular system.
dorsal aorta
detected detected
regionalHLF mRNA was expressed in the endothelial cells of the dorsal aorta.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Epas1 probeA
Entity Detected:Epas1, endothelial PAS domain protein 1 ( MGI:109169)
Sequence:sense strand is shown

>Epas1 probeA
GCATGCCCCTGCCTGCCCCGCCGTCTTGACCTGCCAGCTTCACTTCCATCTGTGTTGCTATTAGGTATCT
CTAACACCAGCACACTTCTTACGAGATGTACTCAACCTGGCCTACTGGCCAGGTCACCAAGCAGTGGCCT
TTATCTGAAATGCTCACTTTATTATCCATGTTTTAAAAAAACATAGTTGTTGTACCTGCTATGTTTTACC
GTTGATGAAAGTGTTCTGAAATTTAATAAGATTTTCCCCCTCCCTCCCTCCCTTGAATTACTTCTAATTT
ATATTCCCCAAAGGTTTTTCTCTCTCTCATTCATATCCATACTAACAAGCATGGTGGCTGGTGCCTCTCC
CTAGGAAAGCTTTGGCGTCATTCAACTCAAGTGTTCTTGTTCTTGTTGCCAAAGAGAAAAGGATTTTCCT
CCACTGTGGATTCTCCCTCTCCCCCCACCCCCACATACACACAC
nt 3025 - nt 3488 of D89787.1
Notes:The Epas1 (mHLF) probe used in this study by Ema et al., 1997 [PMID:9113979] is described as follows: "mHLF probe (nucleotides 3025-3488)." Editors Note: the mRNA sequence for mHLF was submitted by Ema, M. as D89787.1.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, 1997 [PMID:9113979] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1073/pnas.94.9.4273] [ PMID:9113979] Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y, Fujii-Kuriyama Y 1997 A novel bHLH-PAS factor with close sequence similarity to hypoxia-inducible factor 1alpha regulates the VEGF expression and is potentially involved in lung and vascular development. Proc Natl Acad Sci U S A (94):4273-8
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE