Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5261

Epas1 endothelial PAS domain protein 1 ( MGI:109169)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5261 EMAGE:5261 EMAGE:5261 EMAGE:5261
Fig 7D. Copyright: This image is from Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, Proc Natl Acad Sci U S A 1997 Apr 29;94(9):4273-8. [PMID:9113979] Copyright 1997 National Academy of Sciences, U.S.A. Fig 7E. Copyright: This image is from Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, Proc Natl Acad Sci U S A 1997 Apr 29;94(9):4273-8. [PMID:9113979] Copyright 1997 National Academy of Sciences, U.S.A. Fig 7G. Copyright: This image is from Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, Proc Natl Acad Sci U S A 1997 Apr 29;94(9):4273-8. [PMID:9113979] Copyright 1997 National Academy of Sciences, U.S.A. Fig 7H. Copyright: This image is from Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, Proc Natl Acad Sci U S A 1997 Apr 29;94(9):4273-8. [PMID:9113979] Copyright 1997 National Academy of Sciences, U.S.A.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
(D) Lateral view of 10.5dpc embryo hybridized with HLF cRNA probe. (E) Photograph of higher magnification (�45) of dorsal region of 10.5dpc embryo. Arrows indicate the signals in the intersomitic plexus. (G) Transverse section of 10.5-dpc embryo. Arrowheads indicate the signals in the intersomitic plexus. (H) Transverse section of the 10.5dpc embryo. An arrowhead indicates the signal of the endothelial cells of the sprouting blood vessels. Image annotations: H and G in Fig 7D refer to the levels of the sections shown in Fig7H and G respectively.
Expression Pattern Description
Spatial Annotation:
EMAGE:5261Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5261_wholemount__moderate.wlz
5261_wholemount__weak.wlz
5261_wholemount__notDetected.wlz
5261_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5261_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
sympathetic nervous system
detected detected
HLF became prominent in the sympathetic ganglia
cardiovascular system
strong strong
regionalHLF became prominent in the sprouting vessels of the head mesenchyme. High expression in vascular endothelial cells, including the dorsal aorta and intersomitic plexus
dorsal aorta
strong strong
regionalHigh expression in vascular endothelial cells, including the dorsal aorta and intersomitic plexus
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Epas1 probeA
Entity Detected:Epas1, endothelial PAS domain protein 1 ( MGI:109169)
Sequence:sense strand is shown

>Epas1 probeA
GCATGCCCCTGCCTGCCCCGCCGTCTTGACCTGCCAGCTTCACTTCCATCTGTGTTGCTATTAGGTATCT
CTAACACCAGCACACTTCTTACGAGATGTACTCAACCTGGCCTACTGGCCAGGTCACCAAGCAGTGGCCT
TTATCTGAAATGCTCACTTTATTATCCATGTTTTAAAAAAACATAGTTGTTGTACCTGCTATGTTTTACC
GTTGATGAAAGTGTTCTGAAATTTAATAAGATTTTCCCCCTCCCTCCCTCCCTTGAATTACTTCTAATTT
ATATTCCCCAAAGGTTTTTCTCTCTCTCATTCATATCCATACTAACAAGCATGGTGGCTGGTGCCTCTCC
CTAGGAAAGCTTTGGCGTCATTCAACTCAAGTGTTCTTGTTCTTGTTGCCAAAGAGAAAAGGATTTTCCT
CCACTGTGGATTCTCCCTCTCCCCCCACCCCCACATACACACAC
nt 3025 - nt 3488 of D89787.1
Notes:The Epas1 (mHLF) probe used in this study by Ema et al., 1997 [PMID:9113979] is described as follows: "mHLF probe (nucleotides 3025-3488)." Editors Note: the mRNA sequence for mHLF was submitted by Ema, M. as D89787.1.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Ema M; Taya S; Yokotani N; Sogawa K; Matsuda Y; Fujii-Kuriyama Y, 1997 [PMID:9113979] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1073/pnas.94.9.4273] [ PMID:9113979] Ema M, Taya S, Yokotani N, Sogawa K, Matsuda Y, Fujii-Kuriyama Y 1997 A novel bHLH-PAS factor with close sequence similarity to hypoxia-inducible factor 1alpha regulates the VEGF expression and is potentially involved in lung and vascular development. Proc Natl Acad Sci U S A (94):4273-8
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE