Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5276

Epor erythropoietin receptor ( MGI:95408)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5276
Fig6K of [doi:10.1128/MCB.23.17.6103-6116.2003] Mol Cell Biol 2003 23(17):6103-16 [PMID:12917333] Otto DM; Henderson CJ; Carrie D; Davey M; Gundersen TE; Blomhoff R; Adams RH; Tickle C; Wolf CR, Identification of novel roles of the cytochrome p450 system in early embryogenesis: effects on vasculogenesis and retinoic Acid homeostasis. � ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2003.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: arrow indicates developing vasculature; fb, forebrain; t, tail.
Expression Pattern Description
Spatial Annotation:
EMAGE:5276Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5276_wholemount__moderate.wlz
5276_wholemount__possible.wlz
5276_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5276_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cardiovascular system
strong strong
regionalEpoR mRNA was expressed at high levels at sites of developing vasculature.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Epor probeA
Entity Detected:Epor, erythropoietin receptor ( MGI:95408)
Sequence:sense strand is shown

>Epor probeA
CCACATAGCCGGGATGCAAAGGCTCTGAGTCTGGGACAAGGCTGTTCTCATAGGGGTGGGAGTAGGGGCC
ATCAATTGATTCCCCTTNGACTCCCTGAAAGCTCCCCTAACTGTAAATTGTTGAGATGCCGAAAACGGTC
ACCACTAGGCATAGGTCCTTCTATTAATGCGGCGCGGTAGA
Notes:The Epor probe used in this study by Otto et al., 2003 [PMID:12917333] is described as generated from I.M.A.G.E. Consortium clone 3972003.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Otto DM; Henderson CJ; Carrie D; Davey M; Gundersen TE; Blomhoff R; Adams RH; Tickle C; Wolf CR, 2003 [PMID:12917333] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1128/MCB.23.17.6103-6116.2003] [ PMID:12917333] Otto DM, Henderson CJ, Carrie D, Davey M, Gundersen TE, Blomhoff R, Adams RH, Tickle C, Wolf CR 2003 Identification of novel roles of the cytochrome p450 system in early embryogenesis: effects on vasculogenesis and retinoic Acid homeostasis. Mol Cell Biol (23):6103-16
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE