Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5317

Ezh2 enhancer of zeste homolog 2 (Drosophila) ( MGI:107940)
TS14 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5317
Fig3C of [doi:10.1128/MCB.21.13.4330-4336.2001] Mol Cell Biol 2001 21(13):4330-6 [PMID:11390661] O'Carroll D; Erhardt S; Pagani M; Barton SC; Surani MA; Jenuwein T, "The polycomb-group gene Ezh2 is required for early mouse development." � ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2001.

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5317Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5317_wholemount__strong.wlz
5317_wholemount__weak.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5317_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
Ezh2 was "expressed broadly " at this stage of mouse development.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Ezh2 probeA
Entity Detected:Ezh2, enhancer of zeste homolog 2 (Drosophila) ( MGI:107940)
Sequence:sense strand is shown

>Ezh2 probeA
GCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAACGTCCAGGAGGCCGCA
GAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCCACCATTAATGTGCTGGAATCAAAGGA
TACAGACAGTGATAGGGAAGCAGGGACTGAAACGGGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAG
AAAGATGAAACTTCGAGCTCCTCTGAAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATA
TTGAACCTCCTGAGAATGTGGAGTGGAGTGGTGCTGAAGCCTCAATGTTTAGAGTCCTCATTGGCACTTA
CTATGACAATTTCTGTGCCATTGCTA
nt 1080 - nt 1455 of U61145.1
Notes:The Ezh2 probe used in this study by O'Carroll et al., 2001 [PMID:11390661] is described as "A 275-bp fragment of the EZH2 cDNA (Laible et al., 1997 [PMID:9214638] ), encoding amino acids 330 to 455, cloned into the pGEM-3Zf vector (Promega). This human EZH2 probe contains 11 base pair mismatches (95% identity) with the corresponding portion of the murine Ezh2 gene and can be used to detect Ezh2 transcripts." Editors note: U61145.1 refers to the human EXH2 sequence in Laible et al., 1997 [PMID:9214638] .
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS14
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:O'Carroll D; Erhardt S; Pagani M; Barton SC; Surani MA; Jenuwein T, 2001 [PMID:11390661] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1128/MCB.21.13.4330-4336.2001] [ PMID:11390661] O'Carroll D, Erhardt S, Pagani M, Barton SC, Surani MA, Jenuwein T 2001 The polycomb-group gene Ezh2 is required for early mouse development. Mol Cell Biol (21):4330-6
 [ doi:10.1093/emboj/16.11.3219] [ PMID:9214638] Laible G, Wolf A, Dorn R, Reuter G, Nislow C, Lebersorger A, Popkin D, Pillus L, Jenuwein T 1997 Mammalian homologues of the Polycomb-group gene Enhancer of zeste mediate gene silencing in Drosophila heterochromatin and at S. cerevisiae telomeres. EMBO J (16):3219-32
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE