Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5319

Ezr ezrin ( MGI:98931)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5319
Fig1B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/j.modgep.2004.03.007] Gene Expr Patterns 4(6): 749-54, Gimeno L; Corradi A; Cobos I; Consalez GG; Martinez S, Ezrin gene, coding for a membrane-cytoskeleton linker protein, is regionally expressed in the developing mouse neuroepithelium. Copyright 2004. [PMID:15465499]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: F - forebrain; D - diencephalon; M - mesencephalon; os - optic stalk; Rh - rhombencephalon; op - otic placode; Is - isthmus; cb - cerebellum; cp - choroidal plexus; T - telencephalon.
Expression Pattern Description
Spatial Annotation:
EMAGE:5319Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5319_wholemount__moderate.wlz
5319_wholemount__weak.wlz
5319_wholemount__notDetected.wlz
5319_wholemount__strong.wlz
5319_wholemount__possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5319_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
diencephalon roof plate
detected detected
regionalRostrally in the neural tube, Ezrin was expressed at the dorsal midline of telencephalic and diencephalic vesicles, where the prosencephalic choroidal plexus will develop in the roof plate.
telencephalon
detected detected
regionalRostrally in the neural tube, Ezrin was expressed at the dorsal midline of telencephalic and diencephalic vesicles, where the prosencephalic choroidal plexus will develop in the roof plate.
4th ventricle
detected detected
regionalCaudally, Ezrin expression was localized in the expanded roof of the fourth ventricle, in the presumptive area of rhombencephalic choroidal plexus.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Ezr probeA
Entity Detected:Ezr, ezrin ( MGI:98931)
Sequence:sense strand is shown

>Ezr probeA
CCAGTGAGGGCATCCTGGATGACCGCAACGAGGAGAAGCGGATCACAGAGGCAGAGAAGAATGAGCGCGT
GCAGCGGCAGCTGCTGACCCTGAGCAATGAGTTGTCCCAGGCCCGGGATGAGAACAAGAGGACCCACAAT
GACATCATCCACAACGAGAACATGCGGCAAGGCAGGGACAAGTATAAGACGCTGCGGCAAATCAGGCAGG
GCAACACCAAGCAACGCATTGACGAGTTCGAGGCCATGTAGAGGCCAGGCTGGGACCAAGGGCAGAGGGC
ACCTCACTGCAGGCAGGTGTCACACTTGGCTCTTTAGTTCTCTTAAGTTTAGACACCCCCTTGCTGTGTT
CCAGTCCCTTAAAGAGCAGTTACGGGGCCTGCATTCTGCCCCGAGACCCAGTGGGCTCCTCCTTGG
nt 1606 - nt 2021 of X60671.1
Notes:The Ezr probe used in this study by Gimeno et al., 2004 [PMID:15465499] is described as "a 415 bp fragment corresponding to nucleotides 1606 to 2021 of the sequence deposited as GenBank entry X60671 (mouse Ezrin cDNA)." Editors note: The authors are referring to X60671.1 as there is only one version of X60671.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Gimeno L; Corradi A; Cobos I; Consalez GG; Martinez S, 2004 [PMID:15465499] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2004.03.007] [ PMID:15465499] Gimeno L, Corradi A, Cobos I, Consalez GG, Martinez S 2004 Ezrin gene, coding for a membrane-cytoskeleton linker protein, is regionally expressed in the developing mouse neuroepithelium. Gene Expr Patterns (4):749-54
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE