Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5353

Foxs1 forkhead box S1 ( MGI:95546)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:5353
Fig2A of [doi:10.1128/MCB.25.13.5616-5625.2005] Mol Cell Biol 2005 25(13):5616-25 [PMID:15964817] Heglind M; Cederberg A; Aquino J; Lucas G; Ernfors P; Enerback S, "Lack of the central nervous system- and neural crest-expressed forkhead gene foxs1 affects motor function and body weight." � ASM. Reproduced with permission from Molecular and Cellular Biology. Reuse of any Licensed Material requires permission from ASM. Copyright 2005.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: trigeminal (V), facio-acoustic (VII-VIII), superior (IXs), and jugular (Xj) ganglia. DRGs = dorsal root ganglia. The authors state the apparent staining seen in the cephalic vesicles and limb buds is also found in the sense control (not shown).
Expression Pattern Description
Spatial Annotation:
EMAGE:5353Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5353_wholemount__moderate.wlz
5353_wholemount__notDetected.wlz
5353_wholemount__strong.wlz
5353_wholemount__possible.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5353_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
detected detected
facial vii ganglion
detected detected
acoustic viii ganglion
detected detected
superior glossopharyngeal ix ganglion
detected detected
superior vagus x ganglion
detected detected
Expressed in the jugular (Xj) ganglia
dorsal root ganglion
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Foxs1 probeA
Entity Detected:Foxs1, forkhead box S1 ( MGI:95546)
Sequence:sense strand is shown

>Foxs1 probeA
CCACTGCCCCTGCCGGCTGACTCCAAAGAACCCTGGGTGGCTGGGAGCTTCCCTGTCCAGGGAGGTTCTG
GCTATCCACTGGGATTACCCCCCTGTCTTTACCGGACTCCGGGAATGTTCTTCTTCGAGTGATTGGCTGC
AGCGGCCCCTCTGTAGGGCTCCTGTCAACTGTTCTCTGGAGACTCAGACTGGCTATATGACCTAGGGCAC
TCTGCAAGAACCCAGCCCTGGCAGGCCAAGGACTGTGAGGATCAGAAGGCAGAAGTGAGCAGTCAGGCAG
GTCCCTTGGGGGCCTCCTGACAAACTTGGGATGTGGGGAAATGGAACCCTTAA
nt 936 - nt 1268 of NM_010226.2
Notes:The Foxs1 probe used in this study by Heglind et al., 2005 [PMID:15964817] is described as "a HindIII/ApaI fragment constituting nucleotides 936 to 1268 of the Foxs1 coding sequence (GenBank accession no. NM010226)."
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Heglind M; Cederberg A; Aquino J; Lucas G; Ernfors P; Enerback S, 2005 [PMID:15964817] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/j.modgep.2005.04.009] [ PMID:15979417] Machka C, Kersten M, Zobawa M, Harder A, Horsch M, Halder T, Lottspeich F, Hrabe de Angelis M, Beckers J 2005 Identification of Dll1 (Delta1) target genes during mouse embryogenesis using differential expression profiling. Gene Expr Patterns (6):94-101
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE