Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5358

Zc3h8 zinc finger CCCH type containing 8 ( MGI:1930128)
TS16 (10 dpc)
in situ hybridisation

Data Images
EMAGE:5358
Figure 6A. [doi:10.1006/geno.2000.6480] Dahm K; Nielsen PJ; Muller AM, "Transcripts of fliz1, a nuclear zinc finger protein, are expressed in discrete foci of the murine fetal liver." Genomics 2001 Apr 15;73(2):194-202. [PMID:11318609]

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5358Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5358_wholemount__moderate.wlz
5358_wholemount__weak.wlz
5358_wholemount__notDetected.wlz
5358_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5358_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
embryo
weak weak
Expression appears ubiquitous using the Fliz1 antisense probe. Presumably because the Fliz1 transcription was low, the staining reaction had to be developed for a long time to detect Fliz1 transcripts.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Zc3h8 probeA
Entity Detected:Zc3h8, zinc finger CCCH type containing 8 ( MGI:1930128)
Sequence:sense strand is shown

>Zc3h8 probeA
TGGCTCCCGGGAACAGACTGATGAACCTGAAGAGAAGCAGCCACGTGTGAGGATGAGTCAAGGCTTTATC
AACCAGCACACGGTGGAACGCAAAGGGAAGCAAGTTTGCAAATATTTCCTTGAAAGGAAATGTATTAAGG
GAGACCAGTGTAAGTTTGATCATGATGCAGAGATAGAGAAGAAAAAGGAAATGTGTAAGTATTATGTACA
AGGATATTGTACCAAAGGAGAGAACTGCCTGTATTTACATAGTGAATACCCTTGCAAGTTTTATCACACA
GGAACCAAA
nt 629 - nt 917 of AF061961.1
Notes:The Zc3h8 (Fliz1) probe used in this study by Dahm et al., 2001 [PMID:11318609] is described as being in vitro-transcribed from the Fliz1 "differential display cDNA clone (position 629-917)". Editors Note: Elsewhere, the authors refer to a 288bp Fliz1 differential display clone. The nucleotide numbering given is presumed to refer to the full-length Fliz1 cDNA sequence in this paper (see Fig2A and AF061961.1).
Chemistry:RNA
Label:digoxigenin
Specimen
Organism:mouse
Age:10 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Dahm K; Nielsen PJ; Muller AM, 2001 [PMID:11318609] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/geno.2000.6480] [ PMID:11318609] Dahm K, Nielsen PJ, Muller AM 2001 Transcripts of Fliz1, a nuclear zinc finger protein, are expressed in discrete foci of the murine fetal liver. Genomics (2001):194-202
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE