| Data Images |
 |
 |
 |
 |
 |
| Figure 3D.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3A.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3E.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3F.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3G.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
 |
 |
 |
 |
 |
| Figure 3G1.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3G2.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3H.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3H1.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
Figure 3H2.
[doi:10.1016/S0006-291X(02)00850-1] Trappe R; Buddenberg P; Uedelhoven J;
Glaser B; Buck A; Engel W; Burfeind P, "The murine BTB/POZ zinc finger
gene Znf131: predominant expression in the developing central nervous
system, in adult brain, testis, and thymus." Biochem Biophys Res Commun
2002;296: 319-27. [PMID:12163020] . |
|
|
| Expression pattern clarity: |
 |
| Find spatially similar wholemount expression patterns: |
 |
|
|
| Notes: |
|
(A) Znf131 sense probe shows no signal at 10.5dpc. (D) At 10.5 dpc, Znf131 signals are visible in the forebrain region (fb), the rostral apical midbrain (mb), the neural tube (nt), the fore limb (fl), and hind limb (hl). (E) A 10.5 dpc embryo shown from the upper back. Staining is detected especially in the neural fold (nf) of the perspective hindbrain (phb), the midbrain, and neural tube. (F) Identical to (D) but showing the planes of embryonic sections shown in figures 3G to 3H. (G) Transverse section of a whole mount stained 10.5 dpc embryo. Znf131 transcripts are detected in the neocortex and the hindbrain (hb) region of the prospective cerebellum (prc). (sv): Telencephalic vesicle forming the second ventricle, (tv): third ventricle, (fv): fourth ventricle, (pp): prospective pons. (H) Transverse section in a more caudal region. Staining is visible especially in the neuroepithelium (ne) (ine: inner neuroepithelium) of the neural tube (nt) and in the fore limb (fl). |
|
| Expression Pattern Description |
| Spatial Annotation: |
 | | | | | Annotation colour key:
 |
strong |
 |
moderate |
 |
weak |
 |
possible |
 |
not detected |
|
| wholemount mapping | | | | |
| Download individual expression domains: |
|
| Download all expression domains: |
EMAGE:5361_all_domains.zip |
| Find spatially similar wholemount expression patterns: |
|
| Morphological match to the template: |
 |
|
| Text Annotation: |
| Structure | Level | Pattern | Notes |
|---|
| future forebrain |
 |
detected |
| | |
| future midbrain |
|
detected |
| regional | Expressed in rostral apical midbrain. |
| neural tube |
|
detected |
| regional | Staining is visible especially in the neuroepithelium (ne) (ine: inner neuroepithelium) of the neural tube. |
| forelimb bud |
|
detected |
| | |
| hindlimb bud |
|
detected |
| | |
| telencephalic vesicle |
|
detected |
| regional | |
| 3rd ventricle |
|
detected |
| regional | |
| mesencephalic vesicle |
|
detected |
| regional | |
| future hindbrain |
|
detected |
| regional | Staining is detected especially in the neural fold (nf) of the prospective hindbrain (phb) |
| 4th ventricle |
|
detected |
| | |
|
| Annotation Validation: |
EMAGE Editor |
|
| Detection Reagent |
| Type: | in situ hybridisation probe |
| Identifier: | Zfp131 probeA |
| Entity Detected: | Zfp131, zinc finger protein 131 ( MGI:1919715) |
| Sequence: | sense strand is shown
>Zfp131 probeA
CAGGACCGGTTTACGGACATCACCCTGATTGTCGACGGACACCATTTTAAGGCCCACAAGGCTGTTTTGG
CTGCCTGCAGTAAGTTCTTCTACAAATTCTTCCAGGAGTTTACTCAAGAGCCTTTGGTTGAAATTGAAGG
TGTTAGTAAAATGGCTTTTCGCCACTTAATTGAGTTCACATACACAGCAAAACTAATGATACAAGGGGAA
GAAGAAGCCAATGATGTGTGGAAAGCAGCAGAGTTTCTACAAATGCTGGAAGCTATTAAAGCACTTGAAG
TCAGGAACAAAGAAAACTCAGCTCCATTAGAGGAAAACACTACAGGAAAAAATGAGGCAAAAAAAAGAAA
GATTGCAGAAACTTCAAATGTTATCACTGAATCATTACCATCTGCAGAATCAGAACCTGTGGAAATTGAG
GTGGAGATTGCTGAGGGCACAATTGAAGTAGAAGATGAAGGCATCGAAGCTTTGGAGGAAATGGCTTCTG
CCAAGCAGTCTATAAAGTACATACAGAGCACAGGCTCCTCCGATGATTCCGCTCTGGCGTTGTTGGCAGA
TATCACCAGCAAGTACCGTCAAGGTGAAAGCAAAGGACAGATTAGCGAAGATGACTGTGCATCTGACCCC
ATAAGCAAACAGGTAGAAGGTATTGAAATTGTGGAACTTCAGCTGTCACATGTGAAGGACTTGTTCCATT
GTGAGAAATGTAACCGTTCATTTAAATTGTTTTACCATTTTAAGGAACACATGAAATCACACTCCACTGA
GAGTTTCAAGTGTGAAATATGCAATAAAAGGTATCTTCGAGAGAGTGCGTGGAAACAGCACCTAAACTGT
TACCACCTTGAAGAAGGTGGAGTAAGTAAGAAGCAAAGAACTGGGAAAAAAATTCACATATGCCAGTACT
GTGACAAACAGTTTGACCACTTTGGACACTTTAAAGAACACCTTCGAAAACATACAGGTGAAAAACCTTT
TGAATGTTCAAATTGTCACGAGCGGTTTGCTAGAAATAGCACTCTCAAATGTCACCTCACTGCATGCCAA
ACTGGAGTAGGAGCAAAAAAGGGCAGGAAGAAGCTTTATGAATGCCAGGTCTGTAACAGTGTATTTAACA
GCTGGGACCAGTTCAAAGATCA
|
| | nt 224 - nt 1365 of AY092766.1 |
| Notes: | The Zfp131 (Znf131) probe used in this study by Trappe et al., 2002 [PMID:12163020] was a "1142-bp murine Znf131 cDNA fragment from the 5'-region (nucleotide position 224-1365 of the cDNA sequence)"
Editors Note: Elsewhere, Trappe et al refer to the identifer of their reported cDNA sequence as AY092766. |
| Chemistry: | RNA |
| Strand: | antisense |
| Label: | digoxigenin |
|
| Specimen |
| Organism: | mouse |
| Strain: | C57BL/6J |
| Age: | 10.5 dpc |
| Theiler Stage: | TS16 |
| Mutations: | none (wild-type) |
| Preparation: | wholemount |
|
| Procedures |
| Fixation: | 4% paraformaldehyde |
|
| General Information |
| Authors: | Trappe R; Buddenberg P; Uedelhoven J; Glaser B; Buck A; Engel W; Burfeind P, 2002 [PMID:12163020] .
Indexed and spatially mapped by EMAGE. |
| Submitted by: | EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU |
| Experiment type: | non-screen |
| References: | [ doi:10.1016/S0006-291X(02)00850-1] [ PMID:12163020] Trappe R, Buddenberg P, Uedelhoven J, Gl�ser B, Buck A, Engel W, Burfeind P 2002 The murine BTB/POZ zinc finger gene Znf131: predominant expression in the developing central nervous system, in adult brain, testis, and thymus. Biochem Biophys Res Commun (296):319-27 |
| Links: | Allen Brain Atlas same gene |
| | BioGPS same gene |
| | International Mouse Knockout Project Status same gene |
| | GEISHA Chicken ISH Database same gene |
| | EMBL-EBI Gene Expression Atlas same gene |
| | BrainStars same gene |
| | ViBrism same gene |
| Data Source |  |
|
icon to keep this page displayed.)
