Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5395

Hcn4 hyperpolarization-activated, cyclic nucleotide-gated K+ 4 ( MGI:1298209)
TS16 (27 Somite no.)
in situ hybridisation

Data Images
EMAGE:5395 EMAGE:5395 EMAGE:5395 EMAGE:5395 EMAGE:5395
Figure 2B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2E. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687]
EMAGE:5395 EMAGE:5395 EMAGE:5395 EMAGE:5395
Figure 2F. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687] Figure 2I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S1567-133X(03)00125-X] Gene Expr Patterns 3: 777-83, Garcia-Frigola C; Shi Y; Evans SM, "Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development." Copyright 2003. [PMID:14643687]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: central nervous system (black arrowheads); la-left atrium; lhsv-left horn sinus venosus; acv-anterior cardinal vein; ccv-common cardinal vein; lv-left ventricle; nt-neural tube;oft-outflow tract; ra-right atrium; rhsv-right horn sinus venosus; rv-right ventricle; sa-prospective sinoatrial region; st-septum transversum; sv-sinus venosus. A shows the right side of the embryo in B. C and D show higher magnifications of the left and right sides of the heart, respectively. E-I show sections of the same embryo.
Expression Pattern Description
Spatial Annotation:
EMAGE:5395Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5395_wholemount__moderate.wlz
5395_wholemount__possible.wlz
5395_wholemount__notDetected.wlz
5395_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5395_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
central nervous system
detected detected
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles.
future forebrain
detected detected
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles.
telencephalon
detected detected
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles.
optic cup
detected detected
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles (including the optic stalk and vesicles)
optic stalk
detected detected
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles (including the optic stalk and vesicles).
diencephalon
detected detected
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles.
future hindbrain
strong strong
regionalExpression confined to proliferating neuroepithelia lining the brain ventricles, specially at the hindbrain roof.
septum transversum
strong strong
common atrial chamber right part
detected detected
spottedSome positive cells in the dorsal wall of the right atria (prospective sinoatrial (SA) node).
common cardinal vein
strong strong
regionalThe wall of the right common cardinal vein as it enters the right horn of the sinus venosus maintained high Hcn4 expression, while the same portion of the left common cardinal vein exhibited reduced expression.
future midbrain
weak weak
regionalLow levels of HCN4 mRNA could be found in the midbrain neuroepithelium (data not shown)
sinus venosus right horn
strong strong
Asymmetric signal, only in the right side, at the junction between the common cardinal vein and the sinus venosus.
sinus venosus left horn
moderate moderate
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Hcn4 probeA
Entity Detected:Hcn4, hyperpolarization-activated, cyclic nucleotide-gated K+ 4 ( MGI:1298209)
Sequence:sense strand is shown

>Hcn4 probeA
GTGGGAAGAGATCTTCCACATGACCTATGACCTGGCCAGCGCCGTGGTACGCATCGTGAACCTCATTGGC
ATGATGCTTCTGCTGTGTCACTGGGATGGCTGCCTGCAGTTCCTAGTGCCCATGCTGCAGGACTTCCCCC
ATGACTGCTGGGTGTCCATCAATGGCATGGTGAATAACTCCTGGGGGAAGCAGTATTCCTACGCCCTCTT
CAAGGCCATGAGCCACATGCTGTGCATTGGGTATGGACGGCAGGCACCCGTAGGCATGTCTGACGTCTGG
CTCACCATGCTCAGCATGATCGTGGGGGCCACCTGCTATGCCATGTTCATCGGCCACGCCACTGCCCTCA
TCCAGTCGCTAGACTCCTCCCGGCGCCAGTACCAGGAGAAGTATAAACAGGTGGAGCAGTACATGTCCTT
CCACAAGCTCCCGCCTGACACCCGACAGCGCATCCATGACTACTATGAACACCGCTACCAAGGCAAGATG
TTTGATGAGGAAAGCATCCTGGGTGAGCTGAGTGAGCCACTTCGAGAGGAGATCATCAACTTTAACTGCC
GAAAGCTGGTGGCATCCATGCCACTGTTTGCCAACGCAGATCCCAACTTTGTGACATCCATGCTGACCAA
GTTGCGTTTCGAGGTCTTCCAGCCTGGGGATTACATCATCCGCGAAGGCACCATCGGCAAGAAGATGTAC
TTTATCCAGCACGGCGTGGTCAGCGTGCTCACTAAGGGCAACAAAGAGACCAAGCTGGCTGATGGCTCCT
ATTTTGGAGAGATCTGCTTGCTGACCCGGGGTCGGCGCACAGCCAGCGTCAGAGCGGATACTTATTGCCG
CCTCTACTCACTGAGCGTGGACAACTTCAAT
nt 1200 - nt 2070 of NM_001081192.1
Notes:The Hcn4 probe used in this study by Garcia-Frigola et al., 2003 [PMID:14643687] corresponds to "amino acids 400-690". The authors thank Dr Bina Santoro who very kindly provided the template cDNA. Editors Note: the probe start and end co-ordinates with respect to the Hcn4 mRNA RefSeq NM_001081192.1 were deduced using the given information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD-1
Age:27 Somite no.
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Garcia-Frigola C; Shi Y; Evans SM, 2003 [PMID:14643687] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S1567-133X(03)00125-X] [ PMID:14643687] Garcia-Frigola C, Shi Y, Evans SM 2003 Expression of the hyperpolarization-activated cyclic nucleotide-gated cation channel HCN4 during mouse heart development. Gene Expr Patterns (3):777-83
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE