Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5402

Hells helicase, lymphoid specific ( MGI:106209)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5402 EMAGE:5402
Fig 3B (anti-sense). [doi:10.1002/dvdy.1128] Copyright: This image is from Raabe EH; Abdurrahman L; Behbehani G; Arceci RJ, "An SNF2 factor involved in mammalian development and cellular proliferation." Dev Dyn 2001; 221: 92-105. Reprinted with permission of Wiley-Liss Inc. [PMID:11357197] Fig 3A (sense). [doi:10.1002/dvdy.1128] Copyright: This image is from Raabe EH; Abdurrahman L; Behbehani G; Arceci RJ, "An SNF2 factor involved in mammalian development and cellular proliferation." Dev Dyn 2001; 221: 92-105. Reprinted with permission of Wiley-Liss Inc. [PMID:11357197]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Fig3B shows an embryo hybridised with antisense-probe and Fig3A shows a control embryo hybridised with sense-probe. Image annotations: forelimb (arrow) and hindlimb (arrowhead); pharyngeal arches/pouches (Ph); the atrium of the heart (h).
Expression Pattern Description
Spatial Annotation:
EMAGE:5402Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5402_wholemount__moderate.wlz
5402_wholemount__weak.wlz
5402_wholemount__possible.wlz
5402_wholemount__strong.wlz
5402_wholemount__notDetected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5402_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
forelimb bud
strong strong
hindlimb bud
strong strong
branchial arch
strong strong
Expressed in pharyngeal arches and pouches.
tail
detected detected
regionalExpressed distally.
heart atrium
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Hells probeA
Entity Detected:Hells, helicase, lymphoid specific ( MGI:106209)
Sequence:sense strand is shown

>Hells probeA
ATGGAACAACAGCAATTGGAGGAACAGAAGAAGAAAGAGAAGTTGGAGAAAAAAAAACGGTCATTAAAAC
TTACAGAGGGTAAAAGTTTAGTTGATGGGAATGGAGAGAAACCAGTCATGAAAAAGAAAAGAGGAAGAGA
AGATGAATCTTATAATATTTCAGAGGTCATGTCAAAAGAGGAAATTTTGTCCGTAGCTAAAAAACATAAG
GATAATGAGGATGAAAGCTCTTCCACTACGAGTCTTTGTGTAGAAGATATTCAGAAAAATAAGGATTCAA
ATAGTATGATTAAAGATAGATTGTCTCAAACTGTTAGGCAGAATTCTAAATTCTTTTTTGACCCAGTTCG
GAAATGTAACGGACAGCCTGTACCCTTTCAACAACCAAAGCATTTCACAGGAGGAGTAATGAGGTGGTAC
CAAGTAGAAGGCATGGAATGGCTTAGGATGCT
nt 311 - nt 762 of AF155210.1
Notes:The Hells (Pasg) probe used in this study by Raabe et al., 2001 [PMID:null] 11357197 is described as a "451 nucleotide digoxigenin-UTP-labeled riboprobe corresponding to nucleotides 311-762 of mPASG coding sequence (lying 5' of the conserved helicase domains)". Editors note: The authors submitted their 'full-length mPASG cDNA' sequence to Genbank, Accession No. AF155210. Their description of the probe region suggests that the co-ordinates given refer to the position within the coding region of the cDNA (which starts at nt 104 in AF155210.1). However, as the most 5' helicase domain starts at nt 779 within AF155210.1, it is assumed the authors are referring the co-ordinates to the nucleotide numbering of the complete AF155210.1 sequence, and not the 'coding sequence' as stated.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Raabe EH; Abdurrahman L; Behbehani G; Arceci RJ, 2001 [PMID:11357197] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1002/dvdy.1128] [ PMID:11357197] Raabe EH, Abdurrahman L, Behbehani G, Arceci RJ 2001 An SNF2 factor involved in mammalian development and cellular proliferation. Dev Dyn (221):92-105
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE