| Type: | in situ hybridisation probe | 
| Identifier: | Hells probeA | 
| Entity Detected: | Hells, helicase, lymphoid specific ( MGI:106209) | 
| Sequence: | sense strand is shown
 >Hells probeA
ATGGAACAACAGCAATTGGAGGAACAGAAGAAGAAAGAGAAGTTGGAGAAAAAAAAACGGTCATTAAAAC
TTACAGAGGGTAAAAGTTTAGTTGATGGGAATGGAGAGAAACCAGTCATGAAAAAGAAAAGAGGAAGAGA
AGATGAATCTTATAATATTTCAGAGGTCATGTCAAAAGAGGAAATTTTGTCCGTAGCTAAAAAACATAAG
GATAATGAGGATGAAAGCTCTTCCACTACGAGTCTTTGTGTAGAAGATATTCAGAAAAATAAGGATTCAA
ATAGTATGATTAAAGATAGATTGTCTCAAACTGTTAGGCAGAATTCTAAATTCTTTTTTGACCCAGTTCG
GAAATGTAACGGACAGCCTGTACCCTTTCAACAACCAAAGCATTTCACAGGAGGAGTAATGAGGTGGTAC
CAAGTAGAAGGCATGGAATGGCTTAGGATGCT
  | 
|   | nt 311 - nt 762 of AF155210.1 | 
| Notes: | The Hells (Pasg) probe used in this study by Raabe et al., 2001  [PMID:null] 11357197 is described as a "451 nucleotide digoxigenin-UTP-labeled riboprobe corresponding to nucleotides 311-762 of mPASG coding sequence (lying 5' of the conserved helicase domains)".
Editors note: The authors submitted their 'full-length mPASG cDNA' sequence to Genbank, Accession No. AF155210. Their description of the probe region suggests that the co-ordinates given refer to the position within the coding region of the cDNA (which starts at nt 104 in AF155210.1). However, as the most 5' helicase domain starts at nt 779 within AF155210.1, it is assumed the authors are referring the co-ordinates to the nucleotide numbering of the complete AF155210.1 sequence, and not the 'coding sequence' as stated. | 
| Chemistry: | RNA | 
| Strand: | antisense | 
| Label: | digoxigenin |