Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5638

Wnt8a wingless-related MMTV integration site 8A ( MGI:107924)
TS11 (7.5 dpc)
in situ hybridisation

Data Images
EMAGE:5638 EMAGE:5638 EMAGE:5638
Scale bar is 200 microns. Lateral view, anterior left. Scale bar is 200 microns. Anterior view. Scale bar is 200 microns. Posterior view.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5638Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5638_wholemount_moderate_3D_1.wlz
5638_wholemount_notDetected_3D_1.wlz
5638_wholemount_strong_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5638_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
primitive streak
detected detected
The submitter describes regionally specific expression in the primitive streak.
Annotation Validation: Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:328252
Entity Detected:Wnt8a, wingless-related MMTV integration site 8A ( MGI:107924)
Sequence:sense strand is shown

>MGI:328252
GGAAGAGAATTCCTTTCCTTTAACTTCTCTTCCCTCGCACTCCCAGCAGCACAGCTGGGTGGAACGGTAT
CTGACACTTAATGGAATACGGTTCTTCCAGGCTCCTCTGAATGTGCACCCAAATCAAACTCCCTCTTTAA
CAAGCTGCTTAAGTCCAAGAGTAACTGCGCAGGAAAGGCTGGGTCCACAAGCCAGGAGCTCCTGGAAGAA
CCGTATTCCATTAAGTTTCAGATACCG
Notes:Submitter information: The probe was made from the entire insert sequence of the IMAGE:541316 clone.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:ICR
Age:7.5 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Owen J. Tamplin, Doris Kinzel, Brian J Cox, Christine E. Bell, Janet Rossant and Heiko Lickert.
Principal investigator:Heiko Lickert, Institute of Stem Cell Research, Helmholtz Zentrum M�nchen German Research Center for Environmental Health (GmbH) Ingolst�dter Landstra�e 1, Neuherberg, Germany D-85764
Submitted by:Owen J Tamplin, The Hospital for Sick Children Research Institute, Rossant Lab Room 13-305 Developmental and Stem Cell Biology Program Toronto Medical Discovery Tower 101 College Street, Toronto, Canada M5G 1L7
Experiment type:screen
References:[ PMID:10654602] Niederreither K, Vermot J, Schuhbaur B, Chambon P, Dolle P 2000 Retinoic acid synthesis and hindbrain patterning in the mouse embryo. Development (127):75-85
 [ doi:10.1186/1471-2164-9-511] [ PMID:18973680] Tamplin OJ, Kinzel D, Cox BJ, Bell CE, Rossant J, Lickert H 0 Microarray analysis of Foxa2 mutant mouse embryos reveals novel gene expression and inductive roles for the gastrula organizer and its derivatives. BMC Genomics (9):511
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE