Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:571

Col2a1 collagen, type II, alpha 1 ( MGI:88452)
TS16 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:571
Fig 5D of Peters et al., 1999 [PMID:10556064] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:571Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
571_wholemount_strong_3D_1.wlz
571_wholemount_moderate_3D_1.wlz
571_wholemount_weak_3D_1.wlz
571_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:571_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
tail somite
detected detected
regionalA segmented expression pattern is detected in the somites and a ventral domain is also detected in the somites between the the fore and hindlimbs.
trunk somite
detected detected
regionalA segmented expression pattern is detected in the somites and a ventral domain is also detected in the somites between the the fore and hindlimbs. Detected in sclerotome.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:15970
Entity Detected:Col2a1, collagen, type II, alpha 1 ( MGI:88452)
Sequence:sense strand is shown

>MGI:15970
CCTGTCTGCTTCTTGTAAAACCCCCGAACCCTGAAACAACACAATCCATTGCGAACCCAAAGGACCCAAA
CACTTTCCAACCGCAGTCACTCCAGGATCTGCACTGAATGGCTGACCTGACCTGATGATACCCAACCGTC
CTCCCCTCACAGCCCGGACTGTGCTCCCCTTTCTAAGAGACCTGAACTGGGCAGACTGCAAAATAAAATC
TCGGTGTTCTATTTATTTATTGTCTTCCTGTAAGACCTCTGGGTCCAGGCGGAGACAGGAACTATCTGGT
GTGAGTCAGACGCCCCCCGAGTGACTGTTCCCAGCCCAGCCAGAAGACCCCTACAGATGCTGGGCGCAGG
GACTGCGTGTCCTACACAATGGTGCTATTCTGTGTCAAACACCTCTGTATTTTTT
nt 1 - nt 405 of X57982.1
Notes:This probe used in this study by Peters et al., 1999 [PMID:10556064] is described as "the alpha1 subunit (Metsaranta et al., 1991 [PMID:2054384] ) of Collagen II (Col2 a1) ". The probe sequence is depicted in Fig 1B of Metasaranta.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:section
Procedures
General Information
Authors:Peters et al., 1999 [PMID:10556064] . Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10556064] Peters H, Wilm B, Sakai N, Imai K, Maas R, Balling R 1999 Pax1 and Pax9 synergistically regulate vertebral column development. Development (126):5399-408
 [ PMID:2054384] Metsaranta M, Toman D, De Crombrugghe B, Vuorio E 1991 Specific hybridization probes for mouse type I, II, III and IX collagen mRNAs. Biochim Biophys Acta (1089):241-3
Links:MGI:1349752 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI