Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:574

Tfap2a transcription factor AP-2, alpha ( MGI:104671)
TS15 (9.25 dpc)
in situ hybridisation

Data Images
EMAGE:574
Fig 5A, Gavalas et al., 1998 [PMID:9463359] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: Arrowheads mark AP2-positive cells in the second pharyngeal arch (pa2); pa1 - second pharyngeal arch; the bracket marks the second arch.
Expression Pattern Description
Spatial Annotation:
EMAGE:574Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
574_wholemount_strong_3D_1.wlz
574_wholemount_moderate_3D_1.wlz
574_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:574_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
3rd branchial arch
detected detected
regionalExpression was detected in streams of migrating neural crest cells
2nd branchial arch
detected detected
regionalExpression was detected in streams of migrating neural crest cells
1st branchial arch
detected detected
regionalExpression was detected in streams of migrating neural crest cells
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:9015
Entity Detected:Tfap2a, transcription factor AP-2, alpha ( MGI:104671)
Sequence:sense strand is shown

>MGI:9015
AGATCTTTAAGAGAAAAACTGGACAAGATAGGATTGAATCTGCCAGCAGGGAGACGTAAAGCTGCCAACG
TTACTCTCCTCACGTCACTAGTGGAAGGAGAAGCCGTCCACCTAGCCAGGGACTTTGGGTACGTGTGCGA
AACTGAATTTCCTGCCAAAGCAGTAGCAGAATTTCTCAACCGACAACATTCCGATCCCAATGAGCAAGTG
GCAAGAAAAAACATGCTCCTGGCCACAAAACAG
nt 13 - nt 255 of X57012.1
Notes:The Tcfap2a (AP2) probe used in this study by Gavalas et al., 1998 [PMID:9463359] is indicated as that described by Mitchell et al., 1991 [PMID:1989904] ie: pB240, a "240bp BglII fragment of AP-2".
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:9.25 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Gavalas et al., 1998 [PMID:9463359] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9463359] Gavalas A, Studer M, Lumsden A, Rijli FM, Krumlauf R, Chambon P 1998 Hoxa1 and Hoxb1 synergize in patterning the hindbrain, cranial nerves and second pharyngeal arch. Development (125):1123-36
 [ doi:10.1101/gad.5.1.105] [ PMID:1989904] Mitchell PJ, Timmons PM, Hebert JM, Rigby PW, Tjian R 1991 Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev (5):105-19
Links:MGI:1344662 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI