EMAGE mouse gene expression spatial database

Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5803

Itga4 integrin alpha 4 ( MGI:96603)
TS15 (25 Somite no.)
in situ hybridisation

Data Images


Figure 1G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00503-7] Mech Dev 100: 99-103, Pinco KA; Liu S; Yang JT, "alpha4 integrin is expressed in a subset of cranial neural crest cells and in epicardial progenitor cells during early mouse development." Copyright 2001. [PMID:11118892]	Figure 2G. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00503-7] Mech Dev 100: 99-103, Pinco KA; Liu S; Yang JT, "alpha4 integrin is expressed in a subset of cranial neural crest cells and in epicardial progenitor cells during early mouse development." Copyright 2001. [PMID:11118892]	Figure 2H. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00503-7] Mech Dev 100: 99-103, Pinco KA; Liu S; Yang JT, "alpha4 integrin is expressed in a subset of cranial neural crest cells and in epicardial progenitor cells during early mouse development." Copyright 2001. [PMID:11118892]	Figure 2I. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00503-7] Mech Dev 100: 99-103, Pinco KA; Liu S; Yang JT, "alpha4 integrin is expressed in a subset of cranial neural crest cells and in epicardial progenitor cells during early mouse development." Copyright 2001. [PMID:11118892]

Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Notes:

The approximate section planes shown in 2G and 2H are shown in 2I. Abbreviations: b, branchial arch one; h, heart; op, optic vesicle; ot, otic placode; fm, facial mesenchyme; nt, neural tube; st, septum transversum.

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

	strong
	moderate
	weak
	possible
	not detected

wholemount mapping

Download individual expression domains:

5803_wholemount__possible.wlz

5803_wholemount__notDetected.wlz

5803_wholemount__strong.wlz

(what is wlz format?)

Download all expression domains:

EMAGE:5803_all_domains.zip

Find spatially similar wholemount expression patterns:

EMAGE spatially similar wholemount patterns

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

head mesenchyme

not detected

homogeneous

mRNA was no longer detected in these regions as judged by analyses on the whole-mount embryos. (NB. it is expressed in this region in cranial neural crest cells one day earlier in development).

septum transversum

strong

regional

Expressed strongly in a small area of the septum transversum under the developing heart. These cells migrate from the septum transversum onto the surface of the heart which are evidently the progenitors of the epicardium.

Annotation Validation:

EMAGE Editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	Itga4 probeA
Entity Detected:	Itga4, integrin alpha 4 ( MGI:96603)
Sequence:	sense strand is shown >Itga4 probeA CAACAGCAAAAGCAATGATGACTGAAGACTTCTACACTGAGAGAACTGAAAAACTCAGGTTAGGAAAAAG AAATCCTGTTCAGAAGACCCGTCAGAATTTCTTCTTTTTTTCCATGTGCTTATGATTTTGTGACATACTC TTAGTGCAGGGGAAATCTTCAAGAAAGAAGCTACCCAAAGGTGGCTTGTCAGCTTCGGTGGATGAGTGAA GCAAAACACTGAAGCTCTGGATGTACCGGAGAGGTGACCTGTTTAAGACAACTTAAAGCTAGAGAGAATC CAGACTCAGCAGGGCCGACTTAAAGGGAATGATTTTTCAACATCACTGATGAAGTGGCCATCTCAGTGAA ATGGATGCCATGATGTGGAAACTTGTTGGCTTCAAATACTTTTGATTTATCTTCAAACTATGATCATGAT CTTTG
	nt 3233 - nt 3657 of X53176.1
Notes:	The Itga4 probe used in this study by Pinco et al., 2001 [PMID:11118892] "corresponds to a 425 bp HincII(3281)/EcoRI(3706) 3' fragment of pZ5.6 (Neuhaus et al., 1991 [PMID:1840602] )". Editor's Note: Neuhaus et al. describe clones pZ5, pZ6, pK64 and pZ2-5, but no clone pZ5.6. The combined sequence of pZ5, pZ6 and pZ2-5 is shown in Fig4A therein and was submitted to GenBank as X53176.1. EcoRI/HincII digestion of this sequence results in a 425bp fragment as described by Pincobet al, although the cut positions relative to X53176.1 differ from the co-ordinates given by Pinco et al for clone pZ5.6.
Chemistry:	RNA
Strand:	antisense

Specimen

Organism:	mouse
Age:	25 Somite no.
Theiler Stage:	TS15
Mutations:	none (wild-type)
Preparation:	wholemount

Procedures

Fixation:

4% paraformaldehyde

General Information

Authors:	Pinco KA; Liu S; Yang JT, 2001 [PMID:11118892] . Indexed and spatially mapped by EMAGE.
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	non-screen
References:	[ doi:10.1016/S0925-4773(00)00503-7] [ PMID:11118892] Pinco KA, Liu S, Yang JT 2001 alpha4 integrin is expressed in a subset of cranial neural crest cells and in epicardial progenitor cells during early mouse development. Mech Dev (100):99-103
	[ doi:10.1083/jcb.115.4.1149] [ PMID:1840602] Neuhaus H, Hu MC, Hemler ME, Takada Y, Holzmann B, Weissman IL 1991 Cloning and expression of cDNAs for the alpha subunit of the murine lymphocyte-Peyer's patch adhesion molecule. J Cell Biol (115):1149-58
Links:	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source