Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5810

Fmn2 formin 2 ( MGI:1859252)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5810
Fig 4C Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00276-8] Mech Dev 93: 221-31, Leader B; Leder P, Formin-2, a novel formin homology protein of the cappuccino subfamily, is highly expressed in the developing and adult central nervous system. Copyright 2000. [PMID:10781961]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: ov, otic vesicle; rh, rhombencephalon; sc, spinal cord.
Expression Pattern Description
Spatial Annotation:
EMAGE:5810Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5810_wholemount__moderate.wlz
5810_wholemount__possible.wlz
5810_wholemount__notDetected.wlz
5810_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5810_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo
weak weak
Low-level, diffuse expression begins at E9.5 with higher expression in the spinal cord, developing brain structures, and otic vesicle.
future brain
detected detected
higher expression is detected in the spinal cord, developing brain structures, and otic vesicle.
future spinal cord
detected detected
higher expression is detected in the spinal cord, developing brain structures, and otic vesicle.
ear
detected detected
higher expression is detected in the spinal cord, developing brain structures, and otic vesicle.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Fmn2 probeA
Entity Detected:Fmn2, formin 2 ( MGI:1859252)
Notes:The Fmn2 probe used in this study by Leader & Leder, 2000 [PMID:10781961] is described as follows: "An 875 bp riboprobe template of the 3' UTR of formin-2 (Fig. 1A) was generated using PCR (5' primer: TTTTCCTCTGAACCTCTTG; 3' primer: AACGAATACATCATCCTCAC) with embryo clone 1 as a template." Editors note: In Fig. 1A the authors refer to the Fmn2 sequence as Genbank accession no. AF28940. This is a typing error and the actual Genbank accession no. is AF218940.1 which does refer to the sequence of Fmn2 as submitted by Leader & Leder, 2000 [PMID:10781961] . However, when the primer sequences given are compared against AF218940.1 using BLAST, only the 5' primer sequence matches. Assuming the size of probe given is correct, the end of the probe would be beyond the 3' end of AF218940.1. BLAST searching of the sequence surrounding the cloning vector lambda gt10 (U02447.1) with the 3' primer sequence also fails to find a match. The exact and full sequence of the probe is unknown from the description given.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:Swiss Webster
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Leader B; Leder P, 2000 [PMID:10781961] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(00)00276-8] [ PMID:10781961] Leader B, Leder P 2000 Formin-2, a novel formin homology protein of the cappuccino subfamily, is highly expressed in the developing and adult central nervous system. Mech Dev (93):221-31
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE