Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5829

Frem2 Fras1 related extracellular matrix protein 2 ( MGI:2444465)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:5829
Fig2A from [doi:10.1038/ng1549] Nat Genet 2005 37: 520-525, Jadeja S; Smyth I; Pitera JE; Taylor MS; van Haelst M; Bentley E; McGregor L; Hopkins J; Chalepakis G; Philip N; Perez Aytes A; Watt FM; Darling SM; Jackson I; Woolf AS; Scambler PJ, Identification of a new gene mutated in Fraser syndrome and mouse myelencephalic blebs. [PMID:15838507] © Nature Publishing Group. Reproduced with permission from Nat Genet.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: AER, apical ectodermal ridge; EC, ectoderm; LE, lens; MC, mesodermal core.
Expression Pattern Description
Spatial Annotation:
EMAGE:5829Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5829_wholemount__moderate.wlz
5829_wholemount__weak.wlz
5829_wholemount__notDetected.wlz
5829_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5829_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
forelimb bud apical ectodermal ridge
detected detected
lens pit
detected detected
ear
detected detected
regionalthe gene is expressed in the otic vesicle.
4th branchial pouch endoderm
detected detected
Expressed in endoderm of the pharyngeal pouches
3rd branchial pouch endoderm
detected detected
Expressed in endoderm of the pharyngeal pouches
2nd branchial pouch endoderm
detected detected
Expressed in endoderm of the pharyngeal pouches
1st branchial pouch endoderm
detected detected
Expressed in endoderm of the pharyngeal pouches
4th branchial arch ectoderm
detected detected
the gene is expressed in the ectoderm of the branchial arches.
3rd branchial arch ectoderm
detected detected
the gene is expressed in the ectoderm of the branchial arches.
2nd branchial arch ectoderm
detected detected
the gene is expressed in the ectoderm of the branchial arches.
1st branchial arch mandibular component ectoderm
detected detected
the gene is expressed in the ectoderm of the branchial arches.
1st branchial arch maxillary component ectoderm
detected detected
the gene is expressed in the ectoderm of the branchial arches.
1st branchial arch mandibular component mesenchyme
detected detected
regionalthe gene is expressed in the mesodermal cores of the branchial arches.
1st branchial arch maxillary component mesenchyme
detected detected
regionalthe gene is expressed in the mesodermal cores of the branchial arches.
3rd branchial arch mesenchyme
detected detected
regionalthe gene is expressed in the mesodermal cores of the branchial arches.
4th branchial arch mesenchyme
detected detected
regionalthe gene is expressed in the mesodermal cores of the branchial arches.
hindlimb bud apical ectodermal ridge
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Frem2 probeA
Entity Detected:Frem2, Fras1 related extracellular matrix protein 2 ( MGI:2444465)
Sequence:sense strand is shown

>Frem2 probeA
CATGGCTACCTTCTCAACCTGGGCCAAGGAAACCACAGTGTCACACAGTTCACCCAAGCTGACATTGATG
ACATGAAAATATGCTATGTCTTGAGAGAGAGAGCAAATGCCACAAGTGATATGTTCCATTTCATAGTGGA
AGATGACGGTGGAAACAGGTTAACCAACCAGCATTTTCGACTGAATTGGGCGTGGATCTCCTTTGAAAAA
GAGTATTACTTGATCAACGAAGACTCCAAATTTCTAGATATTGTTCTTACACGCAGAGGATACTTGGGAG
AAACTTCATTTATAAGTATCGGCACCAGGGATGGGACTGCGGAAAAAGACAGAGACTTCAAGGGTAAAGC
TCAGAAACAGGTACAGTTCAACCCCGGCCAGACCAGGGCCTCGTGGAGAGTGCGCATCCTGAGCGACGGG
GAACACGAGCACTCGGAGACCTTCCAAGTGGTTCTCTCGGAGCCTGTGCTGGCAATCCTGGAGTTCCCCA
CAGTGACTACAGTGGAGATCATCGACCCAGGAGACGAATCAACCGTGTTCATTCCCCAGTCTGAGTACTC
TGTTGAAGAAGATGTGGGTGAGCTGTTCATTCCCATCAGGAGAAGTGGAGACATCAGCCGGGAGCTGATG
GTGATCTGCTACACACAGCAAGGGACAGCCACCAGCACTGTGCGGACGTCCGTGCTCTCTTACTCTGACT
ACATCTCCAGGCCC
nt 5083 - nt 5796 of AJ833643.1
Notes:The Frem2 probe used in this study by Jadeja et al., 2005 [PMID:15838507] is described as follows: "a Frem2 probe comprising nucleotides 5,083-5,796 by RT-PCR amplification from C57BL6/J skin RNA." Editors note: AJ833643 is given by the authors in the manuscript as the identifier for the mouse Frem2 cDNA sequence.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Jadeja S; Smyth I; Pitera JE; Taylor MS; van Haelst M; Bentley E; McGregor L; Hopkins J; Chalepakis G; Philip N; Perez Aytes A; Watt FM; Darling SM; Jackson I; Woolf AS; Scambler PJ, 2005 [PMID:15838507] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1038/ng1549] [ PMID:15838507] Jadeja S, Smyth I, Pitera JE, Taylor MS, van Haelst M, Bentley E, McGregor L, Hopkins J, Chalepakis G, Philip N, Perez Aytes A, Watt FM, Darling SM, Jackson I, Woolf AS, Scambler PJ 2005 Identification of a new gene mutated in Fraser syndrome and mouse myelencephalic blebs. Nat Genet (37):520-5
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE