Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5844

Fzd9 frizzled homolog 9 (Drosophila) ( MGI:1313278)
TS15
in situ hybridisation

Data Images
EMAGE:5844
Figure 4A from [doi:10.1006/geno.1999.5773] Genomics 57(2):235-248. Wang YK; Sporle R; Paperna T; Schughart K; Francke U, Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams-Beuren syndrome. Copyright 1999. [PMID:10198163]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5844Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5844_wholemount__moderate.wlz
5844_wholemount__weak.wlz
5844_wholemount__notDetected.wlz
5844_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5844_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
future brain
detected detected
Fzd9 was evenly expressed in the entire neural tube encompassing the anlagen of the brain and the spinal cord. The level of the signal did not exhibit obvious differences along the rostrocaudal axis of the neural tube.
future spinal cord
detected detected
Fzd9 was evenly expressed in the entire neural tube encompassing the anlagen of the brain and the spinal cord. The level of the signal did not exhibit obvious differences along the rostrocaudal axis of the neural tube.
trunk somite
not detected not detected
homogeneousNo somitic expression is observed at TS15
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Fzd9 probeC
Entity Detected:Fzd9, frizzled homolog 9 (Drosophila) ( MGI:1313278)
Sequence:sense strand is shown

>Fzd9 probeC
TTCATGTCCTTGGTGGTGGGCATCACCAGTGGAGTCTGGGTATGGAGTTCCAAGACTTTTCAGACTTGGC
AGAGCCTGTGCTACCGAAAAATGGCAGCTGGCCGAGCCCGGGCCAAGGCCTGCCGAACCCCAGGGGGCTA
TGGCCGGGGTACCCACTGCCACTACAAAGCCCCCACGGTGGTCTTGCACATGACTAAGACAGACCCCTCT
CTGGAGAACCCCACACACCTCTAGAACATAGGCTAGGCTGTGAGTTATGGTTGCTCCCTCCTTGCCCTCC
CCTCCCCCCTTCAGAGACAGCTGACTAACAGCTGCCCAGCTGTCAAGGTCAGACAAGTGAGACACAGGGG
GCTGAGGACTAGGGTGGGGACCCAGTAAAGCTCAGGGCCTTGACCTTCTGTCTCATGCAGGGAGTGGTCC
TAGTCCACAGAGGGTCCCAGGATAAGAAGGGGCAGAAGGGGGCAGGGTCCAGTGCAGAGTTA
nt 1564 - nt 2045 of NM_010246.1
Notes:The Fzd9 probe used in this study by Wang et al., 1999 [PMID:10198163] is described as follows: "A 500-bp probe from the 3' UTR region of the Fzd9 cDNA was used for all ISH experiments. The probe was generated by PCR amplification with primers 5'-TTCATGTCCTTGGTGGTGGG and 5'-TAACTCTGCACTGGACCCTG." Editors note: With reference to the NM_010246.1 mouse Fzd9 cDNA RefSeq and the primer sequence given, the actual length of the probe is 481bp (~500bp) and covers both the 3' end of the ORF and the 5' end of the 3' UTR.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Wang YK; Sporle R; Paperna T; Schughart K; Francke U, 1999 [PMID:10198163] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/geno.1999.5773] [ PMID:10198163] Wang YK, Sporle R, Paperna T, Schughart K, Francke U 1999 Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams-Beuren syndrome. Genomics (1999):235-48
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE