Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5845

Fzd9 frizzled homolog 9 (Drosophila) ( MGI:1313278)
TS17
in situ hybridisation

Data Images
EMAGE:5845
Figure 4E/F from [doi:10.1006/geno.1999.5773] Genomics 57(2):235-248. Wang YK; Sporle R; Paperna T; Schughart K; Francke U, Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams-Beuren syndrome. Copyright 1999. [PMID:10198163]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5845Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5845_wholemount__moderate.wlz
5845_wholemount__strong.wlz
5845_wholemount__notDetected.wlz
5845_wholemount__possible.wlz
5845_wholemount__weak.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5845_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
telencephalon
strong strong
Expression was strongest in the developmentally youngest part (of the brain), the telencephalon.
future spinal cord
weak weak
Fzd9 expression in the neural tube had decreased (compared to earlier stages), but was still clearly detectable in ISHs of whole-mount embryos. In the spinal cord anlagen of TS17 embryos, expression was strongest in the more caudal, developmentally younger regions and was already expressed in the neural anlagen of the tail bud.
diencephalon
moderate moderate
regionalSignal was slightly enhanced in the rostral half of the diencephalon.
midbrain
moderate moderate
regionalSignal was slightly enhanced in the rostral mesencephalon (midbrain) delineating the border toward the diencephalon.
tail future spinal cord
detected detected
In the spinal cord anlagen of TS17 embryos, expression was strongest in the more caudal, developmentally younger regions and was already expressed in the neural anlagen of the tail bud.
tail somite
not detected not detected
homogeneousAt TS17, weak Fzd9 expression was seen as segmental stripes in the mature, rostral somite derivatives, whereas the younger somitic mesoderm caudal to the hindlimb bud did not express the gene.
trunk somite
weak weak
regionalAt TS17, weak Fzd9 expression was seen as segmental stripes in the mature, rostral somite derivatives, whereas the younger somitic mesoderm caudal to the hindlimb bud did not express the gene.
1st branchial arch maxillary component
detected detected
Fzd9 expression was first detected at TS17 in restricted areas of the nose, the maxillar, mandibular and second branchial arch anlagen.
1st branchial arch mandibular component
detected detected
Fzd9 expression was first detected at TS17 in restricted areas of the nose, the maxillar, mandibular and second branchial arch anlagen.
2nd branchial arch
detected detected
Fzd9 expression was first detected at TS17 in restricted areas of the nose, the maxillar, mandibular and second branchial arch anlagen.
nose
detected detected
Fzd9 expression was first detected at TS17 in restricted areas of the nose.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Fzd9 probeC
Entity Detected:Fzd9, frizzled homolog 9 (Drosophila) ( MGI:1313278)
Sequence:sense strand is shown

>Fzd9 probeC
TTCATGTCCTTGGTGGTGGGCATCACCAGTGGAGTCTGGGTATGGAGTTCCAAGACTTTTCAGACTTGGC
AGAGCCTGTGCTACCGAAAAATGGCAGCTGGCCGAGCCCGGGCCAAGGCCTGCCGAACCCCAGGGGGCTA
TGGCCGGGGTACCCACTGCCACTACAAAGCCCCCACGGTGGTCTTGCACATGACTAAGACAGACCCCTCT
CTGGAGAACCCCACACACCTCTAGAACATAGGCTAGGCTGTGAGTTATGGTTGCTCCCTCCTTGCCCTCC
CCTCCCCCCTTCAGAGACAGCTGACTAACAGCTGCCCAGCTGTCAAGGTCAGACAAGTGAGACACAGGGG
GCTGAGGACTAGGGTGGGGACCCAGTAAAGCTCAGGGCCTTGACCTTCTGTCTCATGCAGGGAGTGGTCC
TAGTCCACAGAGGGTCCCAGGATAAGAAGGGGCAGAAGGGGGCAGGGTCCAGTGCAGAGTTA
nt 1564 - nt 2045 of NM_010246.1
Notes:The Fzd9 probe used in this study by Wang et al., 1999 [PMID:10198163] is described as follows: "A 500-bp probe from the 3' UTR region of the Fzd9 cDNA was used for all ISH experiments. The probe was generated by PCR amplification with primers 5'-TTCATGTCCTTGGTGGTGGG and 5'-TAACTCTGCACTGGACCCTG." Editors note: With reference to the NM_010246.1 mouse Fzd9 cDNA RefSeq and the primer sequence given, the actual length of the probe is 481bp (~500bp) and covers both the 3' end of the ORF and the 5' end of the 3' UTR.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Wang YK; Sporle R; Paperna T; Schughart K; Francke U, 1999 [PMID:10198163] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/geno.1999.5773] [ PMID:10198163] Wang YK, Sporle R, Paperna T, Schughart K, Francke U 1999 Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams-Beuren syndrome. Genomics (1999):235-48
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE