Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5846

Fzd9 frizzled homolog 9 (Drosophila) ( MGI:1313278)
TS19
in situ hybridisation

Data Images
EMAGE:5846
Figure 5A from [doi:10.1006/geno.1999.5773] Genomics 57(2):235-248. Wang YK; Sporle R; Paperna T; Schughart K; Francke U, Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams-Beuren syndrome. Copyright 1999. [PMID:10198163]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5846Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5846_wholemount__moderate.wlz
5846_wholemount__weak.wlz
5846_wholemount__notDetected.wlz
5846_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5846_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future spinal cord
weak weak
regionalAt TS19 (approx day 11.5 pc), neural tube expression further decreased and, in whole-mount embryos, was clearly detectable only in the lumbar to tail regions.
tail future spinal cord
weak weak
At TS19 (approx day 11.5 pc), neural tube expression further decreased and, in whole-mount embryos, was clearly detectable only in the lumbar to tail regions.
brain
weak weak
At this stage, Fzd9 was only weakly expressed in the brain, except in the telencephalon where the signal appeared to be stronger.
telencephalon
strong strong
regionalAt this stage, Fzd9 was only weakly expressed in the brain, except in the telencephalon where the signal appeared to be stronger.
trunk somite
strong strong
regionalAt TS19, Fzd9 expression in the segmental stripes had become upregulated all along the rostrocaudal trunk axis and was strongly reminiscent of the expression patterns of genes activated in the myotomes.
tail somite
strong strong
regionalAt TS19, Fzd9 expression in the segmental stripes had become upregulated all along the rostrocaudal trunk axis and was strongly reminiscent of the expression patterns of genes activated in the myotomes.
limb
detected detected
regionalFzd9 expression encompassed the precartilaginous condensations of the limb skeletal elements.
nose
strong strong
At TS19, Fzd9 expression was predominant in restricted areas of the nose.
embryo
detected detected
regionalExpression is predominant in restricted areas dorsally to the eye, and in the caudal pharyngeal region, ventrally to the primary head vein at the level of the inner ear.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Fzd9 probeC
Entity Detected:Fzd9, frizzled homolog 9 (Drosophila) ( MGI:1313278)
Sequence:sense strand is shown

>Fzd9 probeC
TTCATGTCCTTGGTGGTGGGCATCACCAGTGGAGTCTGGGTATGGAGTTCCAAGACTTTTCAGACTTGGC
AGAGCCTGTGCTACCGAAAAATGGCAGCTGGCCGAGCCCGGGCCAAGGCCTGCCGAACCCCAGGGGGCTA
TGGCCGGGGTACCCACTGCCACTACAAAGCCCCCACGGTGGTCTTGCACATGACTAAGACAGACCCCTCT
CTGGAGAACCCCACACACCTCTAGAACATAGGCTAGGCTGTGAGTTATGGTTGCTCCCTCCTTGCCCTCC
CCTCCCCCCTTCAGAGACAGCTGACTAACAGCTGCCCAGCTGTCAAGGTCAGACAAGTGAGACACAGGGG
GCTGAGGACTAGGGTGGGGACCCAGTAAAGCTCAGGGCCTTGACCTTCTGTCTCATGCAGGGAGTGGTCC
TAGTCCACAGAGGGTCCCAGGATAAGAAGGGGCAGAAGGGGGCAGGGTCCAGTGCAGAGTTA
nt 1564 - nt 2045 of NM_010246.1
Notes:The Fzd9 probe used in this study by Wang et al., 1999 [PMID:10198163] is described as follows: "A 500-bp probe from the 3' UTR region of the Fzd9 cDNA was used for all ISH experiments. The probe was generated by PCR amplification with primers 5'-TTCATGTCCTTGGTGGTGGG and 5'-TAACTCTGCACTGGACCCTG." Editors note: With reference to the NM_010246.1 mouse Fzd9 cDNA RefSeq and the primer sequence given, the actual length of the probe is 481bp (~500bp) and covers both the 3' end of the ORF and the 5' end of the 3' UTR.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Wang YK; Sporle R; Paperna T; Schughart K; Francke U, 1999 [PMID:10198163] , Indexed and Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1006/geno.1999.5773] [ PMID:10198163] Wang YK, Sporle R, Paperna T, Schughart K, Francke U 1999 Characterization and expression pattern of the frizzled gene Fzd9, the mouse homolog of FZD9 which is deleted in Williams-Beuren syndrome. Genomics (1999):235-48
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE