Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5854

Gdf5 growth differentiation factor 5 ( MGI:95688)
TS19 (11.5 dpc)
in situ hybridisation

Data Images
EMAGE:5854
Figure 1A(top left) from [doi:10.1101/gad.1230704] Genes Dev 18(19):2404-17. Guo X; Day TF; Jiang X; Garrett-Beal L; Topol L; Yang Y. Wnt/beta-catenin signaling is sufficient and necessary for synovial joint formation. Copyright 2004. [PMID:15371327]

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:5854Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5854_wholemount__possible.wlz
5854_wholemount__notDetected.wlz
5854_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5854_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
limb
detected detected
regionalGdf5 was expressed in the distal limb bud.
future arm mesenchyme
detected detected
regionalExpression is in the elbow and shoulder joints.
handplate mesenchyme
detected detected
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1336289
Entity Detected:Gdf5, growth differentiation factor 5 ( MGI:95688)
Sequence:sense strand is shown

>MGI:1336289
TGGCACATCCAGAGACTACCCCCTCTACAGGTTCCTGGAGTAACAGAGAGCCTGTGAAGCTGCTGCCCGA
AGTTTCCTGGCAGCCTGCAGGAAAGAGTTCTCAGCAGGCTTACTCTCTGGATGTGATCTGGACTAAAGAG
ATCACCTTCTGAAGATTCCTGCCCAAGGAACAGACTCTGAGTGGGCCTGGGGCTCAGGAAAGGTGTTCTT
AATGAGATTCAGTTCACCATCTCTCCTGCCGGGGCCGGAGACCTTCATTTCTCTCCA
nt 1837 - nt 2103 of U08337.1
Notes:The Gdf5 probe used in this study by Guo et al., 2004 [PMID:15371327] is indicated as that previously used by Storm & Kingsley, 1999 [PMID:10208739] , who refer to the probe used by Storm & Kingsley, 1996 [PMID:9012517] i.e. "a 267 bp PCR product in the 3' untranslated region (bases 1837-2103, Storm et al., 1994 [PMID:8145850] )." Editors Note: U08337.1 is a direct sequence submission to GenBank to accompany Storm et al., 1994 [PMID:8145850] .
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:11.5 dpc
Theiler Stage:TS19
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Guo X; Day TF; Jiang X; Garrett-Beal L; Topol L; Yang Y, 2004 [PMID:15371327] , Indexed by GXD, Spatially Mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1101/gad.1230704] [ PMID:15371327] Guo X, Day TF, Jiang X, Garrett-Beal L, Topol L, Yang Y 2004 Wnt/beta-catenin signaling is sufficient and necessary for synovial joint formation. Genes Dev (18):2404-17
 [ doi:10.1006/dbio.1999.9241] [ PMID:10208739] Storm EE, Kingsley DM 1999 GDF5 coordinates bone and joint formation during digit development. Dev Biol (209):11-27
 [ PMID:9012517] Storm EE, Kingsley DM 1996 Joint patterning defects caused by single and double mutations in members of the bone morphogenetic protein (BMP) family. Development (122):3969-79
 [ doi:10.1038/368639a0] [ PMID:8145850] Storm EE, Huynh TV, Copeland NG, Jenkins NA, Kingsley DM, Lee SJ 1994 Limb alterations in brachypodism mice due to mutations in a new member of the TGF beta-superfamily. Nature (368):639-43
Links:MGI:3510259 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI