Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:5896

Pdgfc platelet-derived growth factor, C polypeptide ( MGI:1859631)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:5896
Fig 2A Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(00)00425-1] Mech Dev 96: 209-13, Ding H; Wu X; Kim I; Tam PP; Koh GY; Nagy A, "The mouse pdgfc gene: dynamic expression in embryonic tissues during organogenesis" Copyright 2000. [PMID:10960785]

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Image annotations: ol, olfactory placode; or, oral cavity; li, limb bud; h, heart; m, myotome, fg, foregut.
Expression Pattern Description
Spatial Annotation:
EMAGE:5896Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
5896_wholemount__moderate.wlz
5896_wholemount__weak.wlz
5896_wholemount__possible.wlz
5896_wholemount__notDetected.wlz
5896_wholemount__strong.wlz
(what is wlz format?)
Download all expression domains: EMAGE:5896_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
branchial arch
strong strong
regionalStrongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
nasal epithelium
strong strong
oral region epithelium
strong strong
Strong expression in epithelial lining of the primitive oral cavity
trunk somite
strong strong
regionalStrongly expressed in the myotome of the somites
central nervous system
not detected not detected
homogeneousThe Pdgfc gene is actively transcribed in derivatives of all three germ layers in the organogenesis-stage embryo, with the notable exception of the central nervous system (CNS) and cranial nerve ganglia
forelimb bud mesenchyme
strong strong
regionalStrongly expressed in the presumptive myoblast in the dorsal aspect of the limb bud of E9.5 embryo
foregut
detected detected
regionalExpression of Pdgfc was found in the endodermal tissues of the foregut and the hindgut
hindgut
detected detected
regionalExpression of Pdgfc was found in the endodermal tissues of the foregut and the hindgut
1st branchial membrane
strong strong
regionalStrongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
1st branchial pouch
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
2nd branchial membrane
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
2nd branchial pouch
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
3rd branchial membrane
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
3rd branchial pouch
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
4th branchial membrane
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
4th branchial pouch
strong strong
Strongly expressed in the epithelial lining of the branchial arches, the branchial pouches and membranes.
cranial ganglion
not detected not detected
homogeneousThe Pdgfc gene is actively transcribed in derivatives of all three germ layers in the organogenesis-stage embryo, with the notable exception of the central nervous system (CNS) and cranial nerve ganglia
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Pdgfc probeA
Entity Detected:Pdgfc, platelet-derived growth factor, C polypeptide ( MGI:1859631)
Sequence:sense strand is shown

>Pdgfc probeA
ATGCTCCTCCTCGGCCTCCTCCTGCTGACATCTGCCCTGGCCGGCCAAAGAACGGGGACTCGGGCTGAGT
CCAACCTGAGCAGCAAGTTGCAGCTCTCCAGCGACAAGGAACAGAACGGAGTGCAAGATCCCCGGCATGA
GAGAGTTGTCACTATATCTGGTAATGGGAGCATCCACAGCCCGAAGTTTCCTCATACATACCCAAGAAAT
ATGGTGCTGGTGTGGAGATTAGTTGCAGTAGATGAAAATGTGCGGACCCAGCTGACATTTGATGAGAGAT
TTGGGCTGGAAGACCCAGAAGACGATATATGCAAGTATGATTTTGTAGAAGTTGAGGAGCCCAGTGATGG
AAGTGTTTTAGGACGCTGGTGTGGTTCTGAGACTGTGCCAGGAAAGCAGACTTCTAAAGGAAATCATATC
AGGATAAGATTTGTATCTGATGAGTATTTTCCATCTGAACCCGGATTCTGCATCCACTACAGTATTATCA
TGCCACAAGTCACAGAAACCACGAGTCCTTCGGTGTTGCCCCCTTCATCTTTGTCATTGGACCTGCTCAA
CAATGCTGTGACTGCCTTCAGTACCTTGGAAGAGCTGATTCGGTACCTAGAGCCAGATCGATGGCAGGTG
GACTTGGACAGCCTCTACAAGCCAACATGGCAGCTTTTGGGCAAGGCTTTCCTGTATGTGAAAAAAAGCA
AAGTGGTGAATCTGAATCTCCTCAAGGAAGAGGTAAAACTCTACAGCTGCACACCCCGGAACTTCTCAGT
GTCCATACGGGAAGAGCTAAAGAGGACAGATACCAGATTCTGGCCAGGTTGTCTCCTGGTCAAGCGCTGT
GGAGGAAATTGTGCCTGTTGTCTCCATAATTGCAATGAATGTCAGTGTGTCCCACGTAAAGTTACAAAAA
AGTACCATGAGGTCCTTCAGTTGAGACCAAAAACTGGAGTCAAGGGATTGCATAAGTCACTCACTGATGT
GGCTCTGGAACACCACGAGGAATGTGACTGTGTGTGTAGAGGAAACGCAGGAGGGTAA
Notes:The Pdgfc probe used in this study by Ding et al., 2000 [PMID:10960785] was transcribed "from the 1.2 kb full length mouse Pdgfc coding sequence". Editors note: Although the authors state that "the full length cDNA for mouse Pdgfc has been deposited in GenBank (accession number: AF286725)", AF286725.1 is 1038nt in length, which is ~200nt shorter than the 1.2kb probe used. The sequence of the remaining 200nt is unreported.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:ICR
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Ding H; Wu X; Kim I; Tam PP; Koh GY; Nagy A, 2000 [PMID:10960785] . Indexed and spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1016/S0925-4773(00)00425-1] [ PMID:10960785] Ding H, Wu X, Kim I, Tam PP, Koh GY, Nagy A 2000 The mouse Pdgfc gene: dynamic expression in embryonic tissues during organogenesis. Mech Dev (96):209-13
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE